Description :
From Genome Similarity Track
Location :
Scaffold_136:285- 1571
Sequence
1286 bases(100 bases per row)
GACCCGGCGCGAATGCAACTGTTCCACGCGCACACATTCACCAGGAAAGCAGCGATTCAAATCGATCTCTAAGAGGAGTACAGCCATAAGCAGGCTCACA
CCCATGCAGGCGCCTATAAACAATGAACTGGTGACAATGGATTTGAGCACGGCCGAGCAGAGTGATATCCACTATTTTGGATGCAAAAAATTGGGGCACA
TGCAACGTGCCTGTCCTGCGGGAGGACATGGAAGTCGATCCTTCCAGAGACCCCAGGGTTGATCCCAGGGTCCGAAGGGCCGCTGATAGAAGCCGTGACC
TAGGGGACAGGGGAATACAGGACACCAGTAGGGGCGGGGATTCATACTAGTGAAGACCGGAGTCATCACGACGGGTACGCGGGTGGCGCGCACAATGATG
GCTTAGTCCCGGAGAGACTGTGTTCTCTCCACACGGAGGAGGGCGGTGGAGGCCTGCTAGTGGTACACATGAGTGTACAGGGATACAATCACCCCTTGAG
AGTGTTGATCGACCCTGGAGCCTTGAAGAACTTTGCTCGACGGCAATGCGTTGCGAGCAATAGTAACAAGTTCTCTGATGCTCTACGCGAGCGTGAAGGG
AACGGACTGGTCTAAGTAAGGCTAGCCGATGGTACAGTGGTAAGAGTACCGAAGGTTCGTGTGAACCTAGTTGTCAAGTTCGAGGACTTTGACAGCGTCG
AGCCGTTCATGGCCCTTGACATGGACAAGTATGACTTGATTCTGGGCATGCCGTGGCTTGAGGAGCACGAACCCTGGATAGACTGGCGTGGAAAAGCCAT
AGGAGCGAGTAAGACTCTGGTCTCTGACAGAGCTTTGATAAGTCATGTTCCCACCTCTACCAGATGACATGGCATTCGTAAGGATGGATGAGACGTACAT
GGGCGTTGTCGAGGCAGTTGCCGACAGCAGAGAAGTAGTTGCAGTGGGCGCTGCAACAGGTCGCAAGACCTCGTCTATCGTGAGATTTGTTCACGGGCCA
TCAGAGGCTAGGTCGATGGACGGGACTTCTAGCCATGCGTACGAAGCGTAAGGCCATAAGATCAAGACTCAGAAAGAGTCCGAGGCGGAGACTACCACGT
CGGTAGATCTCTGCATTCAATGCCATCGCGCCGCACAAGCTTCAACAGTGACCGTACCGACGGACACGCGTCAAGTGGGTAGCATAGTCCCACACAGTGC
GAGTAATACAGTTCCGCATGGAGTTCCGTGAACTCCTAAGGCTGGCGCCATGGCAGTGTCATCGGGCGTAAGTAACAGAGTACCAC