Description :
From Genome Similarity Track
Location :
Scaffold_46:284963- 304232
Transcript NameFunction/comments
Physo_136518hypothetical protein
Physo_136519hypothetical protein
Physo_136520reverse transcriptase
Physo_136521reverse transcriptase

Sequence
19269 bases(100 bases per row)
TCTCAAAGGCCCGCACCAGACATTTTGCGGCGGGCCTTGTCTCAGCCAGTAAGAGTCTTAATAATCGATCGAGAAGCTACCAGAAGTAGGATATCCGTGC
AGCTTCATTTGATTGGTCATTATGATAAAACTATGTATATGTTAAGATCCTGTAGTGCAGACTGCGCTACGAAGTGCACATTACGGGGCGTGTTGCTATG
TACATGTAGTGAGGGCATGATAATGAGGAAGCCTGAGCCAGCTAGCAACACGTGGACATACTTTTCAATGGCATTATTTTGCTCCTTTCAATACAAACTA
GTGTAGGTATGTGATGTATCTAATAGCAGTGGCGTCTTCTCGCTGCACTACGTACCACTCTAATTTCCCGCTTTATTTTGTTTATGCAAGACCAATAAAT
ACAAAACAGGGTAACTAAAGCCCAAATCGTAATTTTCCCAAACTAGATGAGCCGTCCATCGCTTTTTAATATAATGATCCTCGAATGGCACAAGCTTACA
CCTCTAGAAACTGTTGAAATGGAACATACCTCCCAAAATTGATAAATATTACATATTATGATTTATTATGATGAGCTCTGAGCAAATAAACTATTATCTT
TGACAATATATGAAATTGAGTCGGGAGTATTAGTACTATGGTACTATGGTAACATCCTTAGAATCGGCATTATTAGCAATCCCTGCCCCCCCCCCCCCCC
ATCCAAGAAGTCCTTGGATTGAGGCGTTTTCCTGTTTCAACAGGAAATGCTAGCCGGCGAGCTGCTTTCTCTGACAAATTTTTTGATAGTAGGCTGTCTA
AGTAGATAACGGTCTCGTCAGTATTGCAGATTAAGCTCGGGTCAAGTGCACCATAGTTCGTGTTGAAAGCCGTGGTAAACTCCTGGCGCACCTCAACTAG
GTTGTGTTGCTTTCCCGGCAATTAATCGTTTAGATTAACAATTATTAATAGTTGGTGTTTGTAGATTACGACTACATTGTGCAGATGAAGACCTGGATAA
TCTCCGTTGTCTGCGCGTTCTAGCTACGATCGCTTCTCACCTGCCACATTGCAGAAAAGTCCGTTTTGCTTGTGGACATTCTCGACCGTCACGAAATGCG
TGAAGCTAAGTTTATTGTAATTGTGAGCCCAATGCTAAGCTACGGCCTTTCCTGAAAACGCAATGAGCCTATTGGCAATTAGCCATGAGCGTAGTGGGTC
TTCTATGAATGCCAAGCTGATGGGTATCTGGATGCAGAGCAACCGCCATCCTCCGCCACATAATCGACACACACACATAAAATTGGCAAATCAATACGAT
ATGAGAGAGCAACCGAACAAATAGAGCTTGGAAGGCCATCATGCTTGCCATAGCCACAAATGCATTATTACAAAGTTTTAGCACCATACAGCTGCCGCCT
TATGTCGTCACTAATATATCATCTAAAATATTAAGTAAATAGTCAAATTAGAAAAGCAATTAATGAGCCAACCATTTGTCGCATATTTGTGGCCGTTAGA
ATTTTTGTTCATCGCTGTATTTCCATCACCAAAGTGTTACACCAGCCGACCTGCAACTGGTCTAACATGCGCACGCATCGCATTTGCATACATATCCCCA
GTCGACCCTCTTGCTAGGACAAACGGGAGGACAAAATCGTTTTTTTTTTACTTGATTTCAGTATAGAGTACGGCCAAGTATTACCGACACATTGTGGTGC
GATAATACAGCCGCAATTACCCCCCCCCCCTTCGGATTTTTCGTTGGGGCATGCACGGAGACAGCAGAGAAAGAATCACAATGAAAAGGCGGAGGGGGTC
TATGGGAAAGGTGTTACACCTGTACCAAAGGATCCGTCTTCTAGGCTCTGATCGTATAATACCAAGGGAAAACAAGGGCTATACAAAAGGAATAAGTTAG
AAGTTGCTGGCGGCAATGATAAGATGAGGGTTGTGAGGGAAACAGGCGTCTCAACACCATCCCTTTCGAACCGACAACCAAACGCATACAGCCACACTCA
CAAGTGTGGGCTGCCGGTGTAGCGACAGGGATGCTCTTTTCTGGAAGTTGTTTTATTGAATGGACTTAAGAATATCAATCTGGAATGTGCATACCAAATC
ACAATATATGGATATACAGCCTCCACCCTCCTGTTCCTCCAGGCGCCTGGTCGCGAGGATGATAACACTCAGCCTCGCAAGCGCCAGAAGAACGATCATG
GTCAAGCGGCTGAGGCGCTGGGGGCTGCTGAGGTCCCTCACCCGCTTTGGCGTGTATATGGTACTAATTCGCACCACTCATATTTAGGATAAGTTCTGTA
GTGTGCAATTTATGTCCTGGGGCGATTTAGTGTTTAAACGGATAATGCCGATTTGTATACGGTACACAATTCCTGTATTATACCTTCAGATACCAAAAGG
TATTTAAATTGGACCGGTACACGAATTCTAGTCCTACACAGAGTCTTCACTATCCCAATTCGAAAATTCATCGAAACAGTCCTCATTGAAGGCGCCGCCG
TTGTCGCTCACGTCGTTAGTGTCTTCATCGACGCGCTTCTTCGACTTTGAGCAAAACAGCTCGCCGTAAACGCCGTGTCGCGCCCCATGCCAATCTCCAA
ATCTTGGTGAAAATCCAGCTACTGTCACCGAGCGCTCAATCACATCAGCTGGAACATCGCGCCAAGCAACGCTCACCCAGTTCGCCACGGTCTCAACCGA
CGGTGGCTTTGGGTTTTATCCGCGAGTGTAGAGCACAGCATCAGACTTCTTCCAGCCGTCAATGATGGGCGATAGCTTGTCCTTGAACGACTTGTAGATC
CCGATTTTTTTTTTCTTATGTCAGCTCTACGAACCCGGTGCAAGCAATCACTATGGCAAAATATTCACAACACACAAAATCTTAACGGCATATTATCGTG
GACGGGAGAAGCAGCTGTTAAAGGACGTATACCAGACACAGAGATGAAATTATTAATCACGTATCGGCCGATGAGTCCCGTCAGGTGTACTTTTTTGTCC
CAGCTTTGAAAATGCTGACGCTAAAGACAAGTGATGTTTGAAACCCCCATTGTAGATCGCGGAATACGAATGCGTTTTTATCAGTTGTAACATTAGTTTA
CGGCGTGATATAGCCTGTCAGCTCAACAGTAAGCTTTCTTGTTCTTTTAGACCTCGTATGTGACTAGCAACCCGTATCCCAACCAAGGCTCGTCCATGCC
ATCCCCGACTTGTGAAATCCACCAATGAAAGGGCTAGATAACAAAGGTTTTATCCAATGATTAGTCTTGCAGAAACCAGACAGTATTCCAACCGATCCGA
CCATATTTGGTTGGAAATTTTGCAGAATACTTTTTATGTCATACAAATTCCCATACAAATGCATATTCTAAAAATATCGTGCAGTTTCCAACCAAGGCAG
CTGTAGTTGCGGTTGCATGAAGCACCAACAGCGCTAAAGCCATGTCGATCGCTTCCCTCGCTCCAGCTAACAGAAAGAAGGCGAGAACGATGGTTCTGAA
CTCCTTCACCACGTTCCTCACGTCTGAGAACATAACATCCGACGCCGCCTATAAACTCATCGACGCCGACAAGACAGGTAAGGTGCTGAGAATCATGTTA
GATACGTATGCATATTCCCTAGCTAGATCGACAGACAAAGTGCTACCAACGAATACGTGTCTTGCATATTTCGGAAACGTTAAAAACTGGATGCTGGATA
AGTATCCACAACAGGGAGCAATCGTGAAGCCACAGCTACAAAAAATCCTATTTGGGCTGGGAAAATATTGTAGCAACCGAGAAGACGGCTCGTTAGAAAA
GAAGGCCCCACCATGCTCCAAACAAGACCTGGAGAATATAGTTCGACTGCTGTACAAGTCTGATTCTGCGGATACCGTCTACCTCGACGCTGCCGTTGTC
GTCATGATGTGGTACCTGTACGGGCGAAGCTCTGATGCCGAGCAACTAGAGAAACAACAGCTCTCAAGATTTTCTGCTAAGTTGTGAAAGGGTAATAGTT
ACCATCGTCCATTAAAATTGTACTGATCAAAATTATGTCTTACTAGGTGGCGTACTCTCCCTTCGCTTCAAGAGAGTTAAAACGGCTCTGCTGCAAGGCA
TTTCGCTGTTCAAAGACCCGACAAACTTTTTAACATGTCCTTTATTCGCTGTAGCTGCGCCTTTTTAATGCAAACGGCTCCGTGCAAGCGCATGTTCCCG
CAATTCATGGATACAAAGCGGAGCGCCGCTAACGTGGATGACGTGGAAGAACTTAGCCTGGTCGAGCTCCTTGAAGCTGATGATGACCAGACAACGATGT
CGGAAGTCAAGCCGGTGTCGGGCAAGCCTATGTGAGCAGGTTGTTAGTCAGAGTCAAGGATATTGCAGCAGCAACAGAGGTCAGGCTTACCCCAGAACTC
ACATCTCACTCGTTTCGGCGCGGCGCTGCCATGCACGCCAACGACGGAAGCCTGGCCGAAAACTGGACTATTGAGCGGGGCGGCTGGCAACTTGGCCGTG
TCAACAAAAGCTTTTGGGTCCATGCTTGGTACCACCCAAGCCGATCAAAATGTTACCCGTGTTCTGAGCGGATGGACGCTGAAGGAAGGCGCCCGGCTTC
CTTCGATGTGTGCACTCGATGGCCCCATCCGCGAGCGTGCAGGTAAACTGCAGGCCTTGGTCTTTGCAATCACGCTGAGTTTCGACGAAACAGCCCTCAA
TCTTGACGACGGAGTCGCCGATGTCTTGATGGCGACGCTCGTGATGCACTACCCCGACATGCTGTTCCTGTCCGATCAGAGCGCCTTTATCGTCTGGATG
CGGGAAGCCATGGCGGCTCGGGCCATAGGTGAGCCGGAGGTGCTGGCTTGGAGCGAGACAATTCGGCGTGCCTTCACCCCTCCGCCTCCCAAGGTTGAGT
CGAGTGCCAATGGCGCCCAGTCCGAAGCTGCGGTGGTGCTGTTGAAGCGCCAGTCGGAGCAGATCGATATCATCATCCTACAGAACAAAAGGCTAGATGA
ATGACTGTTAGCAGTGGAGGAACAACTTCGAGCACAATTAGACGCAGCTGCACCAAACCCGCGTAAAGGCGCTGCAACGCCAAGTCGAGGGAGTCCAGCC
ACTGTGCCATCATCCACCACCAAGTCCGTGCGTCCGAAGAAGAAAGGGTCGCAGTCGCTTTCGGCACTTTGGTACGAGAGGTTCACTGCCGAGCCTATTG
TATACGCATCCCGCTCTGTCAAAAAGACAACACTATAGGAGTTTAGGCACGCTGTAGGATACATGATGCTGTTCTTACCGATTGGCTTCGCACTCGACGA
AGCAGCCACTGCGTTTAAGAACGAGGTGCTCAACGAGGGAGAGCAAGCGCAAGCAAATGCTCTCGCTTTCCTGAAAGCAAACGGATATTCAGCTCTCGCT
GCCGGCACAGTGTAAGCATATACGTACCCTTGTAGGCTGCCGCTGATGCTGGCCCCGGAGGCTATCACTCCCGCCCGAGGCCAGGCACGTGTCTGCGTCG
CCGCCGGCCCCTGTCCGCTGGTCGCTGTGTGTGGTCGCTGTGCCTCTCTGGTTTGCAGGCTGATTGATTCTTTCGAACTTAGCTGTCGTATCACTAAAGA
TGAATAAATGTCATTAAAACGAATTGATGTAGTACCGGTATTGGTTGGACACCTTGGTTGGAGCGTTGGAATTTCGACGGTATGAAGTGACTCAGTGGCC
TTACCTCCCTCCAAGTTCTTATAAGGCAAATTGTCAGTTTAGTAGAATTTTCGATAGCAACTTTTAGCCAACCACCCCTGCTTGTAATATTGACCGCAAG
GTATATGAAAATGTAGCTCAAGATTTCAGCAATCAGAGACTATACCAGCTAACTAAATCCATGTAATATTCAGCACATTCAACGCAAGCTACTAAGCCAT
CTCGAATTCGAGGTTGTGCCAGTTTAGTAGAGATTTTATCGGGAGTTTGTATTGAAATACCAGCTGTTTCCTCCCTTGCGCCTTGAATAGTTATATTATC
AACCAATCATGGAAGCTATATGCGAAATACTGTCTGTTCAATGGTCAATGTTACACTCTACTAAACTGCTCACTCTCTACTAAAGTGGCAACTTGCCTTA
GGACATTATTATATATTTCATTTAAGCACATGCCTATAGAAGCTATGAACCTTCTCCAGCTCAGAGCAAGAAATTTCCGGCAGCCCTTTGTTCTTCTCGT
TACTTAACGTTCTAAATAAGCGTTCCTTCCCTACATGGCCGAGCCTCAAGTGCCACTCTTTCAAAATATTGCCAACTTTACGGTTTTGGACACGTAAAAT
GTTCGTCTGGACTGGTTTCACGTTCGATACGTAATAAAACTCACCTGTGGTTACTGCTGCAAACAATAGTTTGAACTATTTTATCACGAAAATGAGCAAA
TTTCCAGATTTGGACTGAAAGTGCAGCGGGGCTGCCGTAGCTCCTTGCGTAGAGGAAGACTTTACGACTCAAAGAGTCCAACAGGGTCCTATCCGAGGAC
CCACGAAAACAAGTCAGAGACTTCTTGCAAAAGGCAAAACTGTATTCATTCTCTTATCTGCGGCTCCGCCGCCTACGGTGCAAATACCTGCACTTACTAT
CGACATAACTAACTCTAGTTCATTCTCAATGACTGGCCAGTGGCCCAGGGAGTAACCCTTGGTGTATCGCACACCAAAAGGGTAACCAAAAGGGTAACCT
CCGTGTAACCCCGTTACACTCTCCCCCATCAAGACGGCGAACACGCCAGCTTCAAAAGCACGGACCATTCCGATCTTCCAGTTAAGGTCCAGACCCATCG
CGAGTTCGACTTGTGCTCACAGAGCCTCATTGTCGAATCGGCTGCGCGTGTAACGCATGCACGCAGCCCCCGGGTCTACAGATCAGCAGTCACAAGGCCC
GCGCACGAGCGCCACGCAGCCAGGGCACAGCCCGTCCGTCGAGCCAGCCGCCGAGTCGTCACAGACGCCGAGCGCAAAGGAGGAGCCCGTGCCCAGCACC
CCGCAGAGGCTTTCCATAGCCAAGTATCGTGCAGCGCACCCTCCGAAGCTGCCGCCAGCGAAGATGTCGGAGCATAGCTCAAGCCCGGCTGGCGAGCAGG
CGCCAAGGCGTGTGCGCAATGCGTACGACGATCTCTTCGGGTCTGAGGAGGGCGAGGTCAATGCCAACCCGTCGGAAGGCGATGGCAGATCGCCGCGGAG
TGGGCACAGCTCTTCAAGGACACCACGTTCGCGCTCGCGCTCGCGCTCGCCCCCGCTGCACTCGTTCATCAGCCCAAGGTCAGAGACCCGGGGGTCGCAC
TTACACCCGGACCCGCTGCGCCATGCGCCACCTCTGCCTCCGAGGGACGGGGATGATCCGACGGATCCCGACACAGTCTCCAACCCACTGGACCAGGCTC
AGCGCCGTCAGCTCGAAGAGCGCACCGCGCCAACGCGCTCGAACATACCGGAGGCGTTGCCTATCGTGAACCCCTCTCGGAGAGACTATGGCTTTACAAG
CAGCGAAGATCCATTGAAAGTCGCGAACGACTGGGCCAAAGGCCTGCTGGGTTCATACATCGTAGGGCCGAGAGCCTCGACAACGGCAGATGTAGACGAG
CGCCTCGCGCTGGCCAGCGCTATCTGACGCCGCAGCAGACCACTCCCTCGGAGTATTGCGCCCGGCTGGATGGTCAACTGCACGACCAGTCAGTGCCTCA
GATGCAGCGCATCCCGATGGTCCTCGTTCCCGGTGAGACCGAAGATGAAGATGATGGCCAGTTCCAGGCCTGGGTTGAGAATTTCCGTAAGTTGCCGTCA
ATTGATGCTCTTCGAGCAAGCTATAGAAAGCAAGATGTTCTTCTTGAACGGCGCCTCCGCTTCATGTGGGCGAAGAACATGGCCCGCCAACAAAATCGCT
ATGGTCAAAGACCCCGCGCCCAAGGCGCCAATCGTGCGGTTCGAGATACTCCGCGCCGTGCGTCTACGTCCACGCCTGCGGCGCCAGTTCACGCTTCGCA
CTCGAGCACTCACTCGGATGTGTCATCGTCTCGTTCCAGCGCCGGGAAGCGCGAGGCGACCGACGAGTTGGCTTCGAGCTCGGTGAGTGTCTCGGGTGCT
CCCGATCAAAAGCGTCAACGGCGTCCGGGCAATCTTGCCTCAGGGGCACCTCGTACTCCCACGACGGTGGCTCGCCCCGCCACTTCACCAGATATTGGGT
ATGACCCCGGTGACGACGTCGCTTCAGAAGCAGCTCCACATGGAAGTGAAGCTCTCCGTGCTCATCGAGCAGAGCAGGTGGTCGGCGAGCCGCCGCTAAA
CCCTGCGGTTGTGCGAGCGCAGTTGTCCGAGCTGGAATATCAAGCCGGGCGTGGGCGCGACCACCGCGACTGGGTCGGGAGGCAGTTTGCGCAGAACGAC
GACGCGCTCCGCGCTGTTGAGCGTCGACTCTACGATCTTGAAGATCCACCGGATGACCGGATGGGTCGGTTGGAGCGCTTTGTTCAGGCGCTGCACGACC
AAGTCCAGATCCTGCGCGGGCAGGTTGACGTGCTGGTGCAGCTGCAGCGGGGCGCTGCCCCTCCAACGGTGCCGGCGCCAGCGCCTCCGCGCTCACCTGG
CTCGGGTCGCGGTAACGCTTGAGCAAGCCCACGTAAAACACTGGGTGTGTGCGCATCTTCTTGGGAAGTTTAAGCGTGTACGCAAGGCCCTTATTGGCCA
CGACCTTAAACGGTCCGATGAAGCGAGGACGCAGCTTAGTCTTGAAGACCGCAGAAACGGCATGTGTAGGTAGTTTTTTAGCGTTTAATAACACCAGGTC
TCCGACCTCAAAGTTTTCCATATTACCCCGGCCTCTAGCGTCAGCTTGTTCCTTTTGAACGTCTTGGCTATCAGCCATTGCGTCTCGCACATGCCTTAAG
ACATTCAGACGGATCGACAAGAAGTCGTCCAGTTCCTTACGAACATCACGAGGGCTGACATCAGCAAGCCTATCGGCTAACTCTCCCCTACCAAGCCCAG
AGTCACTACGTGACGGCGTCAACGGGACGCGAGGGTGAGTAAGCCCGTTCACGTAGAACGGAGTGAAGCCTGTCGAGGCATGCACGGCATTGTTCAACGC
GAACTCAACGAGAGGGAGCACCGCGCTCCAGCGCTTAGGCGTCTCCGCACAGACACTGCGAAGAACGTCTTCGACGACGCGGTTCGCGCGCTCAGTTTGA
CCATCGGTCTGGGGGTGATCCGCCGTGGACATATCCAAACGAGTGCCAAGCACCTGAAAGATGTCCGAGTCTCGAAACTCCGCGCTCCCCAGCGTCCGTA
GCAAAGCTACACAACACTCATCACGTGCATACGCGGCACGGATCATGTCAGTGATCGACGGAGTCAGACTCGTGACGTGAGCGAGCTCGTAATCAGGCCT
GCGTGACAACGCGTCGGCCAGCGCATTCTGCCGACCGGGCTTATACTTCACCTCGAAGTTGTACTCCGCAAAGAACGAGAGCCAACGGGCCATCCTCTGC
GAGAGGTGAGGCGACTGTGTCGCAGAGAGTAAGGACGCGTGGTCTGTGAAGATCACAAACGGCTTGGAACCGAGCAGATGAACCCTGAACTTGACGAGGG
CATACTTCATCGCGAGTAGCTCCTTGTCATGGACAGGATAGTTCTTCTCAGCAGCCTTTAGCTGCCGAGACTCGAACGCAATGACCCGCTCACGCCCATC
GGCGTCTGCTTGAAGCAGTGCACAGCCAATGGCAAAATCGGACGCGTCACACACGACGCTGAACGGCCGATCGGGGTCTGGCAGTGCCAGTATCGGTCGG
TGCCTGAAGCAGGCTTTCCTTTACTGCTTCAAAAGCGCTTTGCTGCTCGGCATCCCAACACCATTCAGCATCCTTCTTGAGAAGGTTAGACAATGGCTGT
GCCAACTCAGCATAATTCTCGCTGTACTTGTGCAAATAGTTTGCCAGACCCAGCCACTTGCGCAGGTCTTTCGGGTTCGCAGGAACCGGCCAGTCCACAA
TGGCCTTGACCTTGGCAGGGTCCGCTCGGAGACCACGCTTCCCAATGAAGCATTCCAGAAAGGGAATTTCTTCAGCGCCGAAGATGCACTTGTCGGCATT
GGTGTAGAGCTTGTTCGCTCGCTTACACTCGAGCACGGCTCTCAAATGGTCGATGTGGTTCTCCATATCCGACTTCCCGTGCTCCACACGACTGTGGACG
AAGATGTCGTCAAAGTACGTCTGCGCATATGCGCGATGCGGCCGAAACAACTGCGTCACAAGACGATTAAACGTTGCCGGTGCGTTTGGCAGCCCTTGGG
GCATAACCAACCACTCCCAGAGCATGCCGCTCGGAGTACTCACCGCAGTGAGAGGGATATCACTCGCTCTCATGAGCAGCTGATAGTAGTCATCGACCAA
GTCGAGAGCGCTGTACAACGTGCACCCAACCATGTTGTTCTGAAGAACATCCTTGCGAGGTATCGGCGTTTGTGCCGGGATAGTGGCCGCGTTAAGCTTG
TTGAAAGCATGTACAATGCGCCACTTGCCGTTCGGCTTCCTGACACAGAATGTCGGCGTCGAGTGCGGGGACTTGCTTTCGCGCACCAGTCCTGCTTCGT
TCTTGGCACGAAATTAGGCGTCAATGACGTCACACTGTTCCTTGGGAAGTGGCCACTGGCGTGTGACGCAATATTTGGTTCCCGGAACCAAGTCAATTTC
ATGACGAACGCCTCGATCAGGAGGTAGGCCCATAGGCGGGTCCTTCGAGACAACGTCTCCGAACTCCACTACCAACGGGTACAACGGATCTGACGGATCC
TTCAAGACGGCTGAGCCACTACGTTTATTAAGCGCCTGCTTAGTGTCCTCCAGGACCGCTTCGTCCAATAGTGACGACGAGTTTAACTCTTCTTCTGGTC
GTATCATGACCACTTCGGCTAGATCGCCCGCCTTTAAGGCCTCGCCAAACTCGGCGACGGACATCTCCTCAAGCTCGAGGAGAGCACTCACGGAGGGAAG
AGCTTCAAGGCTGATACGTCTCCCGTCAGCCCATTCACGAGCGTGTATAGCTGCTCGCAGCACTCGCGTGGAGCTTCATCGCTCGACACGCTCGACGCCG
CAGACGCTCTGCGTCTCTTCCTCCTCCTCCTCCGCGCTCGAGGCCGAGAGGATGAGGGCGACGTGGCGACAGCGTCGTCACCACATCCAGGCGACAACGC
GCCTCCGTCCATCGTGGACGCCAGCGAGGAATCGCCAACACGGCAATCCTTGGTCATGAAAGCACCAGGCGAGACACGCTCCGCCTTGTCCCCCGCACGG
CCATGCCCAACGGGCCGCGACAAACCGTCGCCGAGCGTCGAACGCCCCAAAGTCGATGGAGTACGTGCCATCCCACGCGCACGAGGGGGGCCGAGCTCCG
AGTGCCGCGACATACCGTCGCCAGGCGTTAAACGCCCCTGAACTAGCGGAGTACGTGCCGCCCCACAAACGTCCGACGAGCGGTGCTCGGGACCGGCCGA
CGTATACGACGTCGCGTCCACTCCGGGAAGTGCTTCTCCAACAACGGCGTTGTCGACCAACTCGGACACGCCGATGTCCAGCACAGCGACCGACTCGGTC
CAGTGCTCGCGCCAAAAGCGCTTCTGTGTCCTGGCAGAGGTGGGTTCATGACTCGCCAAAGCCCCACCAGGAGAGATGTGCGTAGCACCTAATGTTTTCG
ACCTCCAGTCGATCCAAGGCTCATGGCGTTCCAGCCACGCCATGCCAAGGATGAAGTCATACCTTGAATCCAGGTCCAAGACCAAACAGCGTTCCGTGCT
GTCAAAGTCAAGGAACTTGACGCCCAAGTCCATGGGGACCTTGGGCACCGTGACACGAGTGCCCGTCGCCAAACGGACAGTGACTATGTCACGAGAACGC
GCGCGAAGCGCCACAGCATATAACTCGCTGCCCTCCACGGAGAAACGCCTGGCGTAATTGCCAGACGCCCCCGAATCAATCAAGATCGTCCACGGCTTCT
CGAAGCCCTTCACAGTCGCAATGACGACCAGCAAGCCCGGCTTGCATTTACGTTCTGTGTTTTAGAGTACGGCTCTCTTCGGGACTAGACTCCGTTGTCC
TCCCCCTCCCTAAGGCACTACAGAACCTAGTTCTTCCCCAGTAGGCCGCCCCGCGCCTACTGGGAGTCGCCATTTCCCCGCGACGAACCAGCCTTGTGGC
TCAAAGCGGGGCCGCTCGAACGAGCAGATTGCTGTTTGCGCAGCGGGTAACCCGGCCGCAAGTGCTCGGTGCTGTCGCCGGTGTAGCATCGGCGGATACC
GCGGCGCTGCTCAGCAGCCCGAAGCTCGGCTTCGTCACTTTCAGCGTAGCTGAGGTCCATAGGTTCAGGACCGTTCGACGTACTCGCCTGTGGCGCGCTC
CAGCCGATGCGAGCGGACTTGAAATTGTGCTCGGCGCTTAACGCCACGGCCACAGCTTCCTCGAACGAGGTAGGACGACTGCGGAACACTTCCGTGCGAG
CCACTCCGGTCCTGAGACCATCCATAAACACCGTGACGGTGACAGACTCAGGCAGCGGTTCAGCGAACATGCCGGCGATGAGCGTGCGTAGCTCCTAGAC
GTAGTCCACCAAGTCCTTTTTCCCCTGACGGCAAGCCAGGAACTTGGAACGCACGCGGTATGCGTGGTTCGGCGGCGAGAACACTCGTGAGAGCTGTCGC
TTCAGCTCATCCCACGTCGGGAAGGCGCTGGTGCTCCGATTGAAGCCATTTCGATCTCGCGGATCCAGAGCAGGAGATTCTCAGCCTCCAGACCCTCGAA
CGGCTTGACACTCAGCATGAGTGGCTTGGGTCGAGTCGATCCGGCTTGCGACGCGGCCGACGCCGCTGCAGGCGCCGTCGCGCTCATCCTCTGCTGGATG
TGCTCCAACAGAGCATTCTCGTAACTTGAGAACGCCTCGAGACGCGCGTTCATCGCGTCTGGGCCTTGCGAGGCAAGGTGTGCCACGCCCTCCGGGACCA
ACAGAGACATATGCTTTCTAAGCGCCTCCTGCTGGCCGGGGGCCAAATTCGCGAACGCAGCTTGCTCCATCCTCACAGAGGTACAGTCTAACAGACTCAG
GTGAGGGATTGACTACGAGTGCTACCAAGTGCAGCGGGGCTGCCGTAGCTCCTTGCGTAGAGGAAGACTTTACGACTCAAAGAGTCCAACAGGGTCCTAT
CCGAGGACCCACGAAAACAAGTCAGAGACTTCTTGCAAAAGGCAAAACTGTATTCATTCTCTTATCTGCGGCTCCGCCGCCTACGGTGCAAATACCTGCA
CTTACTATCGACATAACTAACTCTACTTCATTCTCAATGACTGGCCAGTGGCCCAGGGAGTAACCCTTGGTGTATCGCACACCAAAAGGGTAACCTCCAT
GTAACCCCGTTACAGAAAGTGCCTGTAACCTTGCTTAGCCAACTAGTACAAATAGTATGCACTTAGAAATATACAATCAAAATCCCGGTCATATGAAATA
TCCGTCAGCATAGCGCACTCAAATATCCTTCGGGATTTAAGACATCAGTTTTATTGACCCTTCATTAAGTACAATACAAAAACGGTACCATTACCGCAAG
CGAAGACGTGGCTCTGACCAGACTGCGGACTTTCCATAAACCAGCTTCGGTCTGAAGTTATCGCTCGGGCAGCACCTGTATCCTCCCGGGTGTTGCTTTG
ATGTCGGTCCGAAACAACTGTCCTCCTCGCGGCTGTTTGGCTGCCATAAACGGGTCGGCATATTTTAATGGTTTGAATTCGGTTAAGTCATAGCATAGTT
GGCCTTGAAGTTTCCGCCTTTCAAAGAGTAGTAGCACGCCCATCCCTTCCGCCCAGTTTGGTCCTCACATGAGGCGAATGGACGTACTTCTGTCCATGTT
TAGAGAATGTCCTTCTTCGACTGGCCCTGGATAATGCGCCCCAGTGCTCTTCTCACCTTTTGGACAGTGAAATGATCATTTATCATGGACAGGTAGTACG
TCCAAACTCATTTTGCATTTGAAACATGACCTCCATTCACAGTCGCGCACGATTCAGCTACCATGTCCTCTCACAGAAGCTTTTGCATCTTAGTGGCTAC
AGCCACTTGTAGCTCTAACAGACACGTAGGCTAGCGCTCTTCTTCTCGGTCGTCATCAACGTGGGTGCTTGAACTATTGTGTAACAGCAAATTTAGCTTG
TGTGTGTTGGGCTGTCAGTTCGGGAGTGATGGCATTGAGACGTCTGTTTTCTTCGCACGCTTCGGCTCATCATTGCCGCCAGCAAACACTGACATATCTC
CTTGGATGGCACTTAGTTTCGCTTGGTATTATCCAGCCAGAGCCTAGAAATACGTCATTTGGTCTTTACTTCTCTTCTCTATGGTTACACTGAAGTCGTT
TATATAACGCAACACGAAATTGACAGGCATTGTCACTATCCACGCCAAGCGGTCCGTCCAGATACGTCTTCTCTGCAGCCTGACGTTCAAGATCCTTGAA
AGCTTGCTCAACGGTTCCTGTAGCGAAGCAAAGTTTAGTGTCATGTGTGTGGGGACGGAAGTGCTGGAGTACGGAAGCAGGAAGCATAGTCGCGCCCCCT
TCGTCCTTCGGCTAATGCTTCCCAGTGAATCTTGGTTCGTCCCCAACCAAGGCAACCTTGTCGGTGTCCGTGCCGTACCTGTCGGGAATAGAAACCTCCT
TGACACGATAGCGGTTAGCCACGAGCTTCCGCGTCGCCTGGTAGCCGAGTTGAAGCTTGCCCATCCTTGCATAGCCGATGTCAAAATTGAGAGCAAATAT
GTTGATGGTGTTGATCACCATCATATCAGCCATGACGCGCCTCATGGCATTTGAATTCACGCTTCTTGGGGAGAAGTTGTGACGATGTGGCTCCAGGCTT
TCTGTCCGGAGCTACTAAGCTTCTGCCCGAGTTCTGTGAATTCCCGGGCGGGAAGTCTCGCCAGTGTGGCTTTGTGTGGATTGAGCTGCGAGTGGCTTGG
AGTGAGGCGAAGTTAGCGTTTGGCTGTGAATGGAGTCGGCTGACCTGGACGTGTAACTCCGCGGCGTACTGCATGTACGTAGTCGATATTTCCTGACGGC
GGGTAGTACGAGCACCACCCGTCATGGCACAGCGAAAGACGCAGACCGAAGCCAAGACCCCCAAGTACAGCAGCAGCCCCAAGCGACCCTGAACGGACCA
ACACTGTCCCGGACGAAGTAACCATGGTGAGGTGATTCTGGCCGGAGTCCTGATCTGAGATGGCTACACTCAAGGACGTGGATTGCGGGACAAGCACAAG
GATCTGGTACCCGGCGAAGACTCGCCCAGGACGCACATCGACCAGCGACCCTGGCCGAGTCGCTAACGCACATTGCGACTCTGGTCGGGTGTAAGTCTGG
GAGATACGATCAAGGTATACTCAAGTCAAGATGTTTCCGACCGCGTCGGTCTTCTTCTGAGGCGAGCTCATTGCGGAATGAGCTCAGTTTTCTTTCTCCC
AACGTGAAGAATTGACGAATGGTCAATTTCCCGATTAACGTGCCGTGACTCGGCGCGTCTAACCTTGAAGGGGGGGGATGGTGTAACAGGGTTACACGCA
CAAGTGGCTACAGTCACTTGTAACTCTAACAGACACGACGTCTGTTAGAGGTTCGAAAGACTTTCGCGACCTTGGTATAGACACACCAAAGGCTACATAC
ATTTACGATCACCACGACGGGTGGTCCATAGAGACTTAGGATTCCTATTGGCTAAAAGCAGCATCTTTTAGCCAATGAGCGACATGCATAGCATTGGAAT
TCTGCCAACCAGCCGTTGGCAGATTCCTAATTTAGAATATTACATTTAGAGGAAGTCAGAAATCATAAAACAAAAATAGCAGTTCTCATTTTAACCCAAA
AACATTATTTGGATCGTTTATTTAGATTAATCTATACTCAGAGGTCCGAGTATAATTAACTCTAGTTTAAACTAAGCTACGCTTCCTCACACACGTGCGC
ACACGTGTAAGCTAAAGTAGTGAGCCAAAGTAGGCCCATTACACCTGGTAGCACTTTGTAGTCCGTCTAACGACCGACTACCTGAGTTCGTACGTCACCG
CACGAACGCGGAGCTGAGAACCTTCCCATGGATACAGAGGTGCCCATGGTAAGCTCCACTACGCCTGCAACTCACGTTGCACGCGCTGACTGTCCCCACC
TGTCGGATCCAGAGTGGGAGGCCCTCCAACGACTGTCAACAGTCATTGGTGAGGCGGCTGTAGCTACGATGCTGCGTACGCTAACGCCGACAGAGCAACA
CGGTGTTGCTCTGGGTTTCATCCTGAAGGAGCAACGCGATGTTGCTGCTACAACCACGGTGTCGTCCGGGATGACACCACGCGCGCAATCGCTGAAGCTC
AATGTGAGTAACTATGTCGGAAGAGAGGGTGAACCTCTCCTCCGTTGGCTTGTCGAACTCGACACAGCCATTGCGGCCCGACGTATCGCCGACCCGTTGT
CGAAGGTTGCGTTCGCCATGTCATGTCTTGGCGGACGCGCAAGAAGTTGGGCGTATGGACGCCGACTCTCGGATCCTACGTGCTTTAGCACGTACGAGAG
TTTCATGGATGAGCTCAGACGAGCGTTTGAGCCACCGCAAAACGAGTTCCGGTCGAGAGAGGAGTTCCTCGACCTGCAGCAGGGCAAGCATGATGTCCAT
ACTTACGCTCAGAGAGCACGGTACTTGGTCTCGAACATCGTGACCAATCCGATCGACGAGGCGACCAAGATCGTCACGTTCATGAAGGGACTGAGAGATG
AGCCTGTGAAGGCCTATCTCTTCCGTGAGTACCCGAGTACTCTCGAAGCTGCAATTACTCTTGCAATGCAGGAGGAGTTTAGCCTGCGGCAGGCTAAGCT
GTTTGCACATGTGCCGAGGCCACAGCCACGCCCGGTAGTGAGGACGGGAGGCCCAGAACCCATGGACCTCTCGAGTGCTGCAACTGCTGGTCCCAGCAGT
CGCAGGGAAACAATGTGCGATGCCACCGTTGCGGTAGAGTCGGTCACTTTGCTCGGGAGTGCACGGCCCCCGTGCACCAGCAGGGTGGCTATCGCGGCGG
TGCCGGGCACCGTCGCAACCAAACAAAAACGCTGGACGCCAGTAGGCACGGGGCGCCCTACTGGTAATGCAGTTCCGCGTGTCGACCTTGGACACGCGAC
ACTGAGGACTGCAGCCCCTAGTGAGATTCATTCTCACTGCAAGAACCAAGATGACAAGCCTGACCTTGACATCCTGAACGTGAACTCGATGAGAGCAAGC
GGCTCTCTCCGTGCTTTGGTAGATTCTGGCGCGTCGAAGAACTTTGTTCGACTGCGAAGTCTATCAAGGCTTGACTTCGAGGATTTAAAAATACCTCGAA
GTATGTTGGAGGTACGACTGGTGGCAACGGGTGCCGTCGTGAAGACTGGGAAGCGCATGGTGCGCGTGCGCTTCACGTATGAAGATCAAGTGTTTGTCGA
GACCTTTATCGTCCTGGATCTGGGTGATAAGTTTGACATTGTATTGGGCATGGCGTGGCTTGCACGGCATGATCCGGTCATCGATTGGGAGAAGCGCACA
CTCGTGCGCTTCGGTCGCGACAGCGGTACAGTGAGCGATGGCCTTGTTGCCGCTACGCACGCACCGACAGATGCGCGCGACTCCCCACTCGAGACAGCGC
CTAATGCCGCTGTCCCGGAGCGCCCTGGGCGCGCGCGAGCACGCGCGCAAGAGCAGCTAGCGTCGACGTTGCCGCCGACAGCTAATGAAGGAAATGTGTC
GTCCTCGGAGGTCGACACCCGCTTTTCAGCGAATCAGGGAGAGTCTCCGGTCTCAAGGGGTACGGATGACGCAGGCGAGTCACACGCCTCAGCCGTGGAG
GCTGACGCGAATCTGATTGGATCAGGTCTGGCCAATAATAAGAGCCAAGGTGACGTAACGCCGTCGACTCCGGGAGCCGATGGCTTGGGTGAATTTGATT
CGTCGGCTCAGGGAGCCGACGCACCCTCTGTAATGGGGGTCTCCGCCAATGGTTGTCGTCGAGGTATTAAAGTCGCGACGGTTCCGGGATCCGGCGCTGC
GAAAAAGAATTTCGCGTCGACTCCGGGAGTCGACGCACCCTTTGTAACGAAGGGCTCCGCCAATAACAGGCGTCGAGGTGAAGATGGCGTGTCGGCTCCG
GGAGCCGACGCTGCAGGCGGTTCGGACGGTTGCAAACGTTCCGCACCGGAAAAACTTGCATGCTCGGGCTGCACGACGAAGCGCCGTGCGACCAAGCCGG
GCTTGAAGTCGCTCGCCCGCCGGATGTACCCGCCGGCGGTATAAAAGAAGAACACCCGTCCACGGCTGGGCCTGGACGAGGTCAAGAACCAAGCGGAGCC
GAGCTCCGCAAAACAAGAAGACGGCGCATGCGAAGGTCGCTGCCCAAGTCTCGGACTGGGGCCGAGACGCTACAAGAAATGTCTGCCGGGCAGACGGAGG
CTGAGAAGCCGGACGTCGAGACGCTGAACGTCTTGACGCGTACCTGTGCCCTATCAGCGCTTTACACAACAAACCTCCGGCACTGGTTCCGGTACAGGGA
GATGACTCTCGCTAACCCTCCGACACAAGCGTCGGAGTTGACTTCGCTTCCAGTCATGAGCTGGAAGCGCTTCGCGCGTGACTTGCACGATGGACGCATC
GAGCAAATATGCATTCTCTCGGACGCCGAGAGAACGAAGAGCGAGAATGAAGAACTGAGACAGTTCTTCATGGAGAGCACCACTGAGAGTGAGGACACTC
TCACTGCGAAGACGAAGAAGGAGCGTTTTGAAGAGCAGAGCTGGGACTCGTTGAAGACGAATCCCTACTACGAGATCTTACGGAAGTACGCGGACGTGCT
TCCGGAAGAGATCCCTGCGGAGTTTCCGCAGGACAAGGGCATCCAGTACGAGAGTGATCTCGTGCCGGGCACGAAGTACTGTGTCACGCGGCAGTGGCCA
CTGCCGCGAGAGCAGGTCAAAGCGATCGACGACTTCTTCGAAAGTCGTCGCAAAGCTGGACAAGTGCGGGAATCGAAATCCCCGCACAGTGCTCCGACGT
TCTGTTTCAAGAAGCCACAGGGCGGTTGGCGCATCGTTCATGCGTACAACAAGTTGAACGATGCGACGATACCGGTGCAGAAACCGATACCGCAAAAAGA
TGTCATCATTGATTCGATGGCCAGGAGCACTATCTACAGTGCTCTTGATCTGCGCGATAGGTTATATCA