Description :
From Genome Similarity Track
Location :
Scaffold_31:284944- 286551
Transcript NameFunction/comments
Phyci_92308U3 small nucleolar RNAassociated protein putative
Phyci_573350hypothetical protein

Sequence
1607 bases(100 bases per row)
TTACGAGCCATCGACCATCCGGGGAGACGGAGAGGGCCATAACAATATCGGTGTGGCCTGACAGAAGATCGCAAGAAAGCGTGCTGCGGTGCAGCAGTCG
GATCTGTTCACTATTCGTAGCGACGGCCAGCACATCGGAAGGTTCGCCGCTCGCATCAGCCTTCGGGACGTACTTGAGGTTAAGGATATCGTCGTTGTAG
CCGATAATCTGCGTGCGGCGACTCAACTTTTCGTCAAACACCAAAAAGTTCTGCTCCGAAGACACGACCACAACCTCGCGGCGCGAAGATCCCAGTAGTA
AATCCGTGTACGTAAGCGCCGAGGACGCGTCCGACTTTTGCGTGAACAGTGTCTCGCACGCATTGCCACTGCTACGCCACAAGCGCAGCGCACCCATTTC
CCCAGCAGTCAGGAAGTAAATCGCCTTGTCGTCCTGCGTCTTTCCTGCAGACGCATTCTTCACACACTTAAACGTCGACGGCACCACGACAAGCCCCTCC
ACGGCTTCATGCACCAGCACGGTCTTGCTGAGCTTCTGGTCCCTCAAGTCCCAAAAGTTGACAACCTTGTCGCGTCCGGCAGACAGCATCGTGTACCCGT
CTTCCGAGAAGGCCACACTAGTCACCAAACTCATGTGGTCCTGGATGCAGGCCACCTGCTTCTGCGTGTACAGGTCCCAGACGCGCACCGTGGCGTCGTC
ACTGGCCGACACGAGCGACAGCTTGGCGGCGTCCGGGTGGAACTGCACCAGCGTCACGATGCCCGCGTGGCCGCGGAAGTTGTGCGTGCAGAAGCCCTTG
TCCACGTCGAAGACCTTGACCGTGCGGTCGCTGCCTCCCGTGGCCAGCAGCGTGCCCGAGGGGTCGAACCCCATTGCCAGCACGGGCGTCTCGTGTGCCT
TGATGGTGCGCACGCACTTGAAGGAGTCCAGGTCCCACACGCGCAGCAGCAGGTTGCGGCCGGCCGTCACGAGCTGGTTCTTCCTTCCGGGGCGCACGGC
GAACACCACGAACGACTCCTTGGCGTCCTCGTCCTCCACGTCCTGCTGCAGGGTGCGCTGCAGCTCGCCGGTCTCCGCGTCGATGATGGCCACGTCGTCG
TGCAGCATGCAGGCCATGAGCGCGCGGGGCTGCGCGTCGGCGCTGGTGCGGCCGTGGAACAGCTCCACCTTGCCGCCCGTGTACACGCCCGCGTGCGTCT
TGACGGTGCGCCAGCTCTTGGAGAGGCCCGAGCGGGTCGAGTAGCTGCCGGCCGCGCCCGCAGACGCCTGCGCCGAGTCCGCGGAGCCGCTCATGGTCGG
GCAGGAGGAAGGTTGCGGTGTGCCAATACAGGCACTGCGGCGCCTTCCAGTGGAAATTTGACTGGAGTGGAGACACGAATACAGAAGTGGTGTGGCACAC
ACACACATGGATGATGATTTTCGGTGTTCGACACATGGCTACATTGAAGCAGTGAGACGCTAGGCGAAGGTTCGTTTGCCAGCTGGCGGAGACCGAGTGT
AGCGCGTGTACTGCAGCGACATTCGTGGTCAGATTGCTGGGCACTCGTTTGTCAGTCTCGAGTTTTTGTCGTTGCCGTGGTCCTCGTGTTCTTATCCATG
AGGTTAT