Description :
From Genome Similarity Track
Location :
Scaffold_19:28491- 29504
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_19-fgenesh-gene-0.12Oxidoreductase, Gfo/Idh/MocA family protein

Sequence
1013 bases(100 bases per row)
CGGTTAACCCGCTCCGTCTTCTTGGCTTCTTCGAGAATGCGGATCTGCGGCACCACCTCACTTGGGTTCACGAACAGCTTCTCGCCCGAGCGGATCGCAG
CCGCAATGTTGTCGTAGTACACTTCGTACGTTCCGGTCTTGCTTGGGGTGACTTGGGTGACGCCATCAACGCTCGTAAATGTGCCATAAGTAGACTCTGG
TTCGCAGCCGAAGCCACTGTCGCCTGGGCGTTTTCCTTCGCGAAGCTGTGGTTCCTGGATGTCTTCGCCGTATTTCTCAAACTTGCCCTTGGACCCCTCA
ATGATGTACTTTGGTCCAAGGTCCTCCACCATCATGCCCGCCGTGAGAATGACCTGAAGGTGCGGCTGCTTGTTGTACTTGAACTCGAGGCGGAAGTAGT
CGTCGTTCTCGGCGCCTTCGCGCTGGATCTGCACGTCCGCATCCACAGCATCCGGCTCGCCGAACAGTTGCAGCGCCTGGTCGACAAGGTGGGCGCCCAG
ATCGTACAGGTTGCCACCGCCGAGCTCGGCCTTTTCCTTCCAGTAGCCCTTGAGCTTTGGGCGGTAGCGATCAAAGTGCGACTCGAATTTCGTGATCTCG
CCAAACGTCCCAGCGTCGATCAACGAGCGCACGGTCAAGAAGTCGCTGTCCCAGCGTCGGTTCTGGAAGACCGCAAAGAGCACGCCGTGCTGCTTCGCTA
GGTCGACGAGCTCCTGGGCGTCCTTGGCCGTGATCACCAGCGGCTTGTCGACCACGACGTGCTTCTTCGCGAGGATGGCTTGCTTCGCCTGCTCAAAGTG
TACGTGCGTGGGCGTGGATATCACGATGAGCTCCACGGGTGCCGCGAGCAGCTCCTCCATCGAGCGCACGATCCGTGGCGTTGGCTGCAGCACGGAGCTC
TTGGTCGTCGAGCGCTCGAGCACGTGCGTGAGGATGAACTTGCCCGAGCTCTGCAGCAGCGGCGCGTGGAAGACGCTCGAGCCGGTGCCGAAGCCGACGA
GGCCGACGCTGAT