Description :
From Genome Similarity Track
Location :
Scaffold_92:28483- 31359
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_92-fgenesh-gene-0.7Eukaryotic translation initiation factor 5B

Sequence
2876 bases(100 bases per row)
AGAAAGGGAAGAAGACCGCAGCGGCCAAGAAGCCCGCCGCCGGCGGCGCTGTGGACGAATGGGACGACCTGCTGAATGAGTTCAAGCCCGAGACTGAGGC
CGTGGATGCCCCCGCGGCCGCCGCCAAGGACGAGGGCGAGAGCGACAAGCCGGCAGACAAGAGCGACGTGGATGCTGCGGCCGCCGCGTACCTCGCGTCG
CTGGGCGTAGACACGACCGCTGGAGGCGACAAGAAGAACGCCAAGAAGAAGCAGAAGGGCAAGAAGAAGTCCGAGGCGGAGAAGAAGCCCGAGGCCGAGG
CTGCGTCCAAGAAGCCCATTTCGGCCGCCGCCAAGGCCCTGGCCGAGCGCCAGGCCGCACTCCGCGCCGAGCAGGAGCGCATTGAACGCGAACGCTTGGA
GCAGGAACGCCTCGAGCGCGAGGAGGAAGAGCGTCTCGCCGCCGAGGAAGCCGCGCAGGAGGAGATCCGCCGCAAGAAGAAAGAGGCCAAGGCCGCCAAG
GTCGAGCGCCAGAAGAAGGAGGGCACGTACATGACCAAGGCGCAGAAGCTCAAGGTCGCCAAGGCCCAGGCCGCGCTCGAGGCGCTGCAGCAGGCCGGAC
TCGTGCCGGATGCCGCGCAGGACGAGGAGAAGAAGAAGGTCGTGTACTCAAACAACAACAAGAAGAACAAGAAGCCCAAGCAGGAGGAGGTCGTCGAGGA
GGAAGTCGCGGATGACTGGGAGAACGCTGATGGCGACGATGACGCCGAAGCCGAGGCGCCAGACGCGTGGGACGAGGAGGACTGGGAGAGCAGTGACGTG
GTCGCGTCGCTGGACAAGCTCAACACGAACGGCGACGGAGACAATGAGAGCGACGAGGACGTCGAAGACCTGATCCTGCTCGAGCAGAAAAAGGAGCAAG
AGCGCCTCGTGCAGCAGGGCATCGCGCTCAAGAAGCGCCAGGAGGAGCAGGAGGAGCAGGCGCGCATCAACGCCGAGGAGGAGCGCATCCGCTCCAAGGC
GCAGCAGGAGGTTGACCGCAAGAAGCGCGAGGCCGCCGACCGCCGCCGCGTGCGCGAAGAGGAGGCGCTCGCGAACGTCTCGTTGGACAACCTGCGCTCG
CCGATCTGTTGTATCATGGGCCACGTCGACACTGGTAAGACCAAGCTGCTGGACAACATCCGCAAGACCAAGGTACAGGACGGCGAGGCCGGCGGTATCA
CGCAGCAGATCGGTGCGACGTTTTTCCCCGTCGAGGCCATCAAGCAAAAGACTGCGCGCTTGAACGAGAGCATGAAGATCGAGTACAAGCTCCCGGGTGT
GCTTGTGATCGACACGCCTGGTCACGAGTCGTTCACGAACCTGCGCTCGCGCGGCTCGTCGCTCTGTGACATTGCCATCTTGGTGGTCGACATCATGCAC
GGGCTTGAACCGCAGACGCTCGAGTCGCTGCGTCTGCTGCGCCAGAAGAAGGCGCCGTTCGTGGTCGCGCTTAACAAGATCGATCGCTGCTATGGCTGGA
AGACCATGACGGACATGCCGATCCAGGAAGCGCTCAAGCACCAGAACGAACACGTCGTGCGCGAGTTTGAAGACCGCGCGGCCAAGATCATGGTCGAGTT
CTCGGCGCAGGGTCTCAACTCGCAGATCTACTGGCGCAACAAGGACCTCGGCCGCACGATCTCAATCATCCCGACGAGCGCCATCTCCGGCGAAGGTGTC
CAGGACCTGCTCATGATGATCACGCGCCTGACGCAGGAGCGCATGGCCAAGAGTCTCGCGTTCGTCGACATTCTCCAGTGCACGGTGCTCGAGGTGAAGG
TCATCGAGGGGCTCGGTACGACCATTGATACGATCTTGGTGAACGGCACGCTCCATGAAGGCGACACCATTGTTGTGTGTACACTGGATGGGCCCGTCGT
GACGACGATCCGATCGATCCTGACGCCGCACCCGATGAAGGAGATCCGCATCAAGGGCGAGTACATCCACCACCAGACCATGAAGGCTGCCATGGGTGTT
AAGATCTGCGCGCACGGGCTCGAGAAGGCTGTCGCTGGCACGCAGATCCACGTCGTCGGTCCGGATGACGACGTCGAGGAACTCAAGGACTCTGTCATGT
CCGACCTCACGGGCATCTTGGACTCTGTCAAGGCCACGAAGCGTGGCGTGATGGTGCAGGCGTCGACCCTTGGCGCGCTCGAGGCGCTGCTTGAGTTCCT
GCGCACGTGCGACCCGCCGATCCCCGTGTCGTGCGTGAACCTGGGCCCCGTGCACAAGAAGGACGTGATGCGCGCGTCCGTGCAACTTGAGCACCAGAAG
GAGTTCGCGACGATCCTGGCGTTCGACGTCAAGGTCCACAACGACGCGACCGAGCTGTCGCAGGAGCTCGGCGTGCGCATTTTCACGGCCGACATTATCT
ACCACCTCTTCGACCAGTTCACGGCCTACATGGACAACTTCCGGGAAGCGCGGCGCGAGGAGTTCGAGGACGTGGCGGTCTTCCCGTGCGTGCTCAAGAT
CCTGCCCAACTGCATCTTCAATAAGAAGGACCCGATCATCCTGGGCGTGGATGTCGAGGAGGGCATCTTGAAGATCGGCACGCCGCTCGTGGTGCCCATG
GCCGGCGGCGTCTATATCGGCAAGGTCGGCTCGATCGAGCGCGAGCACAAGGAGGTGGAGCGCGCCAAGAAGGGCGCGTCCGTGGCCGTGCGCATCGACA
ACGAAGGCAGCATCACGTACGGCCGCCAGTTCGACCACAAGCACAAGCTCGTATCGCGGTTAACGCGCGCGAGCATCGACGCGCTCAAGGAGAACTTCCG
CACGGACCTGCAGAAGGAGGACTGGCAGCTCGTGATCCGTCTCAAGAAGGTCTTCGACATCATTTAGAGCGCCTCG