Description :
From Genome Similarity Track
Location :
Scaffold_64:284814- 285856
Sequence
1042 bases(100 bases per row)
CAAGGTATCAGCTAAAGAAGCTCAGCAAGGAATTCCGATGTGCTTAATCCAGAAGGCTTTGAGACTGTCGTTCGTGATCGTGTAACACTGCAAGGAAACA
ACAAGGGTTTCCGAATCAGTCAGGAGACTAAATCGATCATGGATCTACTATTTTGGGAGAAGCAGCCAATACTAACTACTATCAATATCAGCTCACGTAT
AGGCTACGCAAAGCTTTTAATCAACAAACAGGCAGCAACTGTTTTGACGGCTATTAAGACATTCGTGCGACTGCACAAGTGTTCTTACTAGTGATAACGG
AGCTGAGTTCATGAATCAGGACGTTCAAAGGTTCATGCAATCTAAAAAGATTGATCACTACAATAATGCGCCAGCTGATCGTGGAACGATGGGGAAGATT
GAACGGTTCAATCGAACGCTAAATCAGATACTCAATAAAATATCGCCAAAGAGACTCACGCAAAAGTTAATCCATGATGTTATATTTACCTACAACAGTT
ACAACAATACCTTTCACAGGTTCATTGGAGCCTTGCACAGTGTGACCGTTCTTAGATCCGATTTGAGCGCAATAGCCATAAATGCCAACAATAATATAGA
TAGATTTACTCCATCGCACAGCTTCTTTATCAAATGTTCGCTTCTAAAGTCGATAAAGAACGTCCATACGTATATCTTACTCGTTATCAATTCTTTCAGC
TGCTTCTCGATTATGAGCTAGCTCAGACTTTATGACTTTTCCTCTCGCCTCGCTTGGATTCATCCCAATTGGAGCTGTAAGCTCAAATTATCTTGTAAGA
ACAAGCAACTGCTTGAAGCTAAAAAGAAAATTGTTCCTATTCTCATAGGTACGGTAAAATCATCTCCAATTGATGAAGATGGATATGTCTGGATTGAAGG
TAACTCAGTTGGCGTATTCAGCAAAAATACTGATCGTCTCAAGCCTTCACTCGCTAAAAGGGTAAATTGGCAAGCCATCATTCATAGATGTATCAATACG
GTAGAAGGTTTGAAGATATTATCTATCGGTAAAAATGATGAT