Description :
From Genome Similarity Track
Location :
Scaffold_25:28480- 33361
Sequence
4881 bases(100 bases per row)
TCACCGGAAGAAGCCCCGTACTGATAGTACGGCCTAAGGTGACCGACGTAGAATGTAGGATGCGTGCGCATCTTACGTGGCAGTTCAATCGTATATGCGT
GCCTAGGCGGCACAGCACACGAAATGGACCGATGAAATTGGGTGGTAACTTTTACTACCCACGTTAGTAACTATGTGTAAAGGTAAGTTTACCGTAGACA
GTAGGACCAAGTCGCCTCTATTGAATAATCGAACATTTTCCCTTCCATTCTTGTCAGCGTTTCTCTTTTTTCGGTTCACCGCCTCTGTGATGGAGTCTTG
TACGAAACGGACAGCCGTTTCGCGAGCCAGTATGAATTCATCTGCTGAATCGCTGTCATTGGCTGCAGTGCTCTTGGAGCGTACTGTAGCAAGATCACTT
GTCGCCTTTGTGAGTGTGACTTTGGACGCACTAGGCGTGATGCTGATTTGATCAGTATCGTGGTCAGTAAGTGCATCTTCGCTCTTACTTTCCTCTTCTT
CACCAAAATCAATGTGATCGACATCGGCGTCGAACGTAGTGACTACATTTTCAACACGTGACGAGTGAGAGCCGGATTGGCGTTCGCTCGAATGAGCCCC
CCCCCCTTAAACTAGAGTCACACTCTAAAAAGGTGGGAAGACGCGGATGGCGCAAGCCATTCACGAAGAATGGCGTGTGCGTCGTCGACGCATGGACTGA
ATTGTTGATGGCGAACTCCACCATCGGCAGGAATTTGCTTTAATTCGTAAAAGAATGGACTTTATCTCGAAGTATCTCCTCGAGGACACGATTGGCGCGT
TCGGTCTGACCATCGGTTTCAGGATGGTCAGACGTGGACATCTTTAAGCGCGTTCCGAGTGTTTTGAACGCTGAACGCCAGAGCTCATCTGTGAACCGCG
GGTCCCGATCGGAAACGAGTTCACGAGGCAACCCATGAAGGCGAAAGACCGTGTCGATAAAGACACGGGCACAAGCCGATGCGTTGATTAATTCAGATAG
AGCAACCAGATGTACCATCTTGCTGAACCTTTCAACGAACACAAGAATACCAGTATTCTTGTGAGAGCCTGCGGGGAATCCGAAGACAAAGTCCATTGAG
ACAGATTTCCAGCACTCGGCCGGGATGGGCAGAGTCTGCAACGGGGCTCGAAGGGAAGGACTAGTCTTCACCCGTTGACATACCTCACAGGCCCGAACGT
ACTTGCGCAAGAACTGATACTGGCGGCCAGTAAAAGTCGCGGCTCACTGTGAGATATGTTTTCTCACGACCACGATGTTCACCAATAGGTGCGTCGTGGT
ACTCATACATGATACGTAGTCGTAGGTCACCATGATCTGGTACGACGACACGAGGCGTGTCGCCGGCAACAGCTGAATATTGGAGTAAGCCGTTGCGAAC
TGTATATCTATCCGTAGAGGATCAATATAATGACAACAACTGTTTTAGGCTCTTCCCGGACGGGTGCGAGAGATGATGCATCAATCGCACCATTCCCTGA
TTATACGCCTTTTGTATGTCTTCCAATAAGGTTGACGACGGGACACTCGAAGTCAGTACCGTGACAGTGGTCGGACCAGTGTCTGGTGTCTCAGCCGGTT
AGATATCGGGTCGGCGCGAAAGTGCATCAGCGACAACATTAAGTCTTCCTGGTTTATATTCGACGGAAAAGTTGTACTCCGCGAAGAATGACAGCCACCT
CGCCATCCGCTGCGAGAGATGTGGACTGTTTACGGCCGTGCGTAAAGATGCATTGTCCGTATAAACAATGAAGGGTCTATCGCCTAGCAGATAGACTCTG
AATTTAACCAACGCGTACTTCATGGCAAGGAGTTCCTTGTAATGGACGGGATAGTTGCGTTCAGCAGGTTGCAGCTGGCGTGACTGATAACAGAAGACAC
GTTCTGCATTGTCTGCATCGTACTGCATTAATGCACAGCCGATTGCAAAGTCACTGACATCACAGACCACGTAGAATGGCCTGTCTTGGTCTGCAATTGC
CAAAACTAGCGATCGTATCAAGCTTTGCGTGATACCTTCGAAAGAGCGCTGGCAATCGGCAATCCATTCCCTCTTCTCGTTCTTCTTCAATAAACGAGAG
AGATGAACAGTCATCTCGGCGTAAATACGTGAATATTTGTGCAAATACGCGGCTAGGCCAGGAACTTTCGAAGTCCCTTGACATCTGTAGGCACCGGCCA
TTCAGTGATCGCCTTGATCTTTTCCGGATCGGGCCGGACGCCATGCTTGCCCATCAAACCAAGAAGTTGTATTTCGTTAGCAGCAAATATACACTTCTTG
ATGTTGGCGTACAACTTATGCTCGCGCATCAGTGTAAGAACCTTCCGGACGTGGAGTCGGTGCACTTTCACATCCGTCTGTCCGTCTATAGCCCGGCTAT
GGATGAACAAATCATCGAAGTAGCTGGACGCGAACTCTCTTACGTATCTTAACAGATTCGTCACACATCTGATGAATGTAGCAGGAGCATTGCTTAGTCC
TTGTGGCACACCAGCCACTCCCAAAGCATACCGCTTGGGGTGCTCACTGTCGTATACGGGATGATCCGTTCCCGCATGAGGATCTGATAGAACCCGTCCA
TCAGATCCATCGATGAAGGATGGCACTCCTTGTCATACCAACTATGATGACACCTTTCCTTGGTATTGATGTTTGAGCCGGTACAGTAGTAGCATTCAAC
TTGTTGAAAGCATGTACTATCCGCCACTCTCCTGTGGCATTTCGCACACAAAAGGTCGAAAAAAAAAGAAGCTATGTGGAGAGGTGGACTCCCTCACATG
GCCGTCTGCTAAGGGATCTGCAAAGAATTTGTCGATCGCTAGTACTTGTTCACGAGGCAATGGCCATTGCTTCATGACACAGTACTTCGAGCCCGGTTTC
AGGTCGATTCCGTGACGAGTACCTTTGTCCTTAGGTAACTCGCACGGCAATGTTTCTGGGAATAAATCCCTGAATTATATCACATCATCGTAGAGAGGAT
TTGCCTTGAGCGATTCCCACAATTGAGATGTACATCGCTCAATCCGAGTCTTCTCATCAAGGACATTCTCGTCCATTGATGAGCTGCTGAGAACCCTATT
CGTTTTCGGCAAATACCATTGCCGACCGAAATATTGGCCACATCCTCTTCCTCTGCGACCAGTATGCAGATTTGATTGACTTTGCCACTACGCAGATCTC
GCAAGAACCTCTTCTATTCCATCGTGGTCAATTGAGTTATTTCCGAAGTTACCTTCGGAGGCGCGATCAGATCAAGTTTGTAGGTACATATACTTGATCC
GTCATTGACCAGGACATTTAATGTCTCTGTTATCTCATGGGAACTTATTTCCGCTGTCTGTAGGGGACTCATTCCCCCAACCTAGCCTCTTGGGCAGTTT
CATTTCTGTATTGACAATCATTGGCAATCGGTTGGTCATAATCTGGGTGTTGTCCACTAAGAGGACAACCATGCCCCGGTCCGCTCGACTTATTCGAGTG
GTGGGCCTTCGGCTCTTCCTACATCGTTATGCAGTCGAATCTTGTTCTACAGTGTGAGGATCTGTCACACTGTGGCCACGTGTAGCCGTGCTAACGACCG
AACCACACGTGAGGCCATAGCACTCACTCGTAGTACATCCACATGGTGGTGGACGCTCCAAGACGTTCATCAGATGGCCTCCTGGTGAACAAGCGACGGG
CATATCGACACTTCGTCGATGCCAGCTGGCTTATGACCAAGAAAACATCAAATTTGCCATCCAAGTCCAAGACGATGAAGTCATCGTCGTTTTGGACTTC
TTTCAGTGTATAGGAAATCCCTACTACACGTTTCATCACTGTTACTGATGCGCCTGTCGCGAGGCGTAACGTCGTCCTCGTTAGAGGGGTCTCTCGCTCG
ATGTATTTAAGCTTGTCATTGTCTAGCGATTGGCGTTGTCCAAAGTTGTTTGACGCCCCAAAATCGACTAGGGCTCGTAGTGACATGTCCTTTGCCACTT
CGAGCTTCAGGGTAATGAGGGAAACCTCATTAACAGATGCAGTAACACACAATGATTGCGTGTTGCGAGAAAATCTCGTCAAGAGGCCTGTAAATTCACT
TGACGTTGCTGGATCAATAGGGTGCTCCGTACCTACTGACACTGACCGTTTTTTGATCGTCCGTTACGTTGTTGCGTTTTCGCAACAACGTCGGACCTAC
GCCTAGGACCCTTCTTGGCCGCTTGACGGTTACTGTTTCCTGTGGTACGTGGTACCGCGTTCGGAGCACTGCATTTGTATGCATAATGCCCTGGCTTTTG
ACATCTATTGCATGTCTGCAATTTCTTATAATTGGTAGCACGAGAGCTTTCACTCTCAGCGTAACAGAGGTTCATCATTTCTGCGCCTCCTCTTTCCTGT
CTCCTCCGGGGACGATAGGAAATCGAACTCACGTGAGCTTGTTTCACGTTAAAATCTTTTTGTTCCGCAACTCGTATTACCTCTTCCAGGGTATTAAATT
CCAATCGGAAGAGATAGGTCCTGACTGGACCGTCTGTAAGACTCTGCATGAACAACGTGATCAATGTTTGTTCATTCGGCGGATTGACCGTGATGCAACT
CGTAAGGTGACGTATATACTGAATGTACGAGTGCACATCACGTTAGCCTTGTTAGATTTTCGGGAGTTCAGAGCGATCCCTAAACTCAGCTCGTGGTGGC
TTGAATGTTTGCCTAAGTAGGGACTTGAAGACTTCTAACGACCCAAAGACAAACGGGTCGTGTAGCTGGAGGCCCAAGGCCCAAGTCTTCGCACGTCCTG
CCAAGTTCGATTGAGCAAATGCGACCTGCATTTGCTCATCGACAATATGACGGACCCTTATGGCGTCATCTGATTCGACAA