Description :
From Genome Similarity Track
Location :
Scaffold_9:284756- 285834
Sequence
1078 bases(100 bases per row)
ATACCGTGCGCGGCACGAACGATCCACACGCAATAGAAGTCACGAAGATGCGCAAGTGCGACGAAGACAATGCCAAGGCGCGTAGTCTTAAGATTGGCAG
GACTAGGGGAGAGCAGGAGTATTAGAATGTAGATAGAACTTAGGACTTAACACAACAACTTGTTGGGTTTACGAAAAATGTAGGACTGGCATCTACGCAG
CATACAGCTTTAGCTCAGATCCCAAACTGACTAAAGTATTCATCAACTTTCTCGTACAACCTTCATACCCGTTCTCACATAACGTTCTGATCTCAGTTTA
CCTTCCCGTTGTGTCAGGTCCCATTTTTCATACATAGATACACGCATATTCCGACACACTTTACTCGAAGAATGCCTTCGACACCACCATGTGCGGTCAT
CGTTTTTTTATGACTGGGAATGGGTTCCGCAATTCGATAGATGTGTATCGTTAATGCCTATGATCATTGTCAGTTTCAGCAGTCGATCTGTCACCAGGGC
CTTGGTCAGTAAGTCGGAAGGGTTGTCTGCTGTCCCGACCTTCCACAACTCGACCGTACTTTTGGCAACTTGATCTCGGACATAGTGCCAGAAAGTTCAA
CGTGCCAAGTTCTTCGACTGTAAGTCGGATCGGTAGCTATAACATACGATGCATGATTGTTAATGCCCACGCGACGATTAATACCTCATTGCGGAAACAT
GTCCATCAGGATGTTGCGCGGACCTTGTCCTTTCATACACGCCTCGCAAGCTGCAATGTATTCCGCTTCGTCAGCAGATTGTGACACTATGGCCTGCCGT
ATCGATTCCCACGATATAGCTCCACCCCCCCATACATGTACAGCACCAGTTATATTCTTCCTGATGTAGAGATCCTTTCATCAGTCTGAGTCGCAATAAC
TATCGACAACCAGCGTCGACATGGCTGCCTTCGTTAACACCTANNNNNNNNNCCGAGTCCGAGTCAAAATTGGAAATTTCACAAGGACTCTCTGGGCCGA
ACAAGCGTTCACTAATTTGATCTGCACTATACCAGTTTGCNNNNNNNNNNTCGTCTCCATGATATGAAAGAACGGTAT