Description :
From Genome Similarity Track
Location :
Scaffold_19:284661- 286894
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G007640Similar to Ptpdc1: Protein tyrosine phosphatase domain-containing protein 1 (Mus musculus)

Sequence
2233 bases(100 bases per row)
ACTGGGATGGGAATCCTGCTGGTATCGCTTGAATGCCTCCGTTCGGGTACCCATAGGCTGCAGCAGCTACTGCTATTCCTTGTTGATGCATTTGCTGCTG
TTGGAGGCTCTGCAATTGGTACAGGAAATCGTGGCTAGGTATCACTATCCCTCCTGGATTCGCCATCATCCCGTCCATAGAGTAAGGAAATCCTTCGTGT
GGCGGCGATGCTATTCGGCTGGAATTAATTCCGCTACTGTTGCTTGAACCAGCAACATGGCTGCCTTGAGCTGACAGCTTTTCGTTGACACTGCGCCGTT
TCTTTCCGCCAGTTGGCGACATACGTGAAGAATTTGCTGGCGAAGCTGATAGCGGTGAAGATGTCATAGCAATCCGCCCGGATGCAGGCAGAAGCGCACG
AGCACTTCCATTTGATTTCATACTCCTTCCTTCATGAAGAACCCTTTGAAAGTCTTTCTTGTTGCTTGTCAAGAAAAAAACCACGAAAAAGTTGAGATCA
AGCGCCAACGCAAATATAGACCCCTAGATGTGTGGTGCAATGTATTTATACCTAACATGTGTATTGTGGAGTAGCATAACCCAAAAAAATTCTCCAGTCT
GGAAAATAAGTCTTCAGCCACGAGATAAAGCAGCAACATACACGACGACGAGTGCCATTCGGCTATGTGCCGCTGACGCAATTGAGCTTTTGGGTGCTCA
CTTTGCTGGACTTGAGATTGCAACGAGTTCACTGATCAGTTTTCGCTAGAAACTACAAATGCAAAAAAAAGAAAACACAGGTATGCATTCAGGTTAGTAC
CAGGTATCTATCTAATCACAAACCGTGATAGGCAAACAAACTTTTGCAAAGCGACGGCGCCATTTCGTTTGCTACCTTCGCCATGATGCTGCATGAATGC
TTGGTGAGATCCAAAGAGATCGCGAAACGGCAAAGCTTATGGTGCTCACAACTAAGATCATGAGTATTTTCGGATCCACTGAACCAATACCTGCAACCGA
TCGATCCAAAAACACCGCTGCCCCGAGTAAGTTGAATGCTCAATTTATAGCTCCAGATCAGACGATTCGAGGAACGCAGAACGTTCCCGCTTTCTAGGCC
GCACTCGGCAACGTGAACGCGCGTTGGCATGCAGAACCTGGCAAACCACGAACTTCCAGTAGCAGCATTTTCCGATCGCGTGGCAACTACGACGTCGCTG
AGTTTAAGCCATGGGGTCGCCTGTCAAAGCGCGAGAGTGGGAGAAAACCCTTACGGTAAAATGCCGACTTTGTGGTGGTGCCAAATGCAAACGCTGTAGC
GAAAGCGCTGCGTTGGCCAAAACGAACTCACCGGTTCTTGGGCTGCACGCCGACTGGGTAACTAATCGCATCTTGGGGATGATGCGTCCGTCGTCTCGGC
TGATGAAGGACTACCAGATTGCGCAGCAGTTTCAAAAGTGAGTAGTCTCATTTCTTTCTCTCTCGCGCATCATTGTCGTGTGTTCCGCTAACCTTTCTGG
AATAGGTTGCGCATATCTGCCGTCTTCAACTTGACCCTGCCAGGAGAGCATCCATACTGCGGTGATGGTCTCGCAGCGAGTGGTTTCCCGTACGACCCAG
AGAAAGATCTCATGGTCGAAAACAGTACGTGTACATTTCGCTTGTAGCAGACTTAGACTTGGACTTGCCCGACTGATCATCTTGATGCTTTGATAAACCA
TCAGTTCACTTCTACAACTTTGGTTGGGAAGACATGACGACGCCGACTTTGCCGTTCATGATGGACATTGTTAAAGTAATGGCGTCGATACTCCAAGATG
GTCACCAAAAAGTAGGTCGCTGCCCACTTACCTTTTTTCTCCGCGAACAAGGCGATGACACGTTGTTCTGAATTATCTGTAGATTTCCGTCCACTGCCAC
GCTGGATATGGACGTACAGGGCTTGCCATCGCGTGCGTTTTGATCTTCATGCACAACATTCCACCTGAGCAAGCCATCAAGATAGTGCGACGTGATCGCC
CTGGATCCATCCAAACGTCAGCTCAGGCAAAGTTTGTGCGCAGCTTCCACGAGTATATCAACACGTCCAAGGTCGTATTTGCGCTTCCATACATTCATGA
CCACTTCACAATCGCCGAGATGATTGAGCATCAAAATCGCATGGTTCATGGTGAGAAATCGTCAGGAACTCGGGTTGCGCTTCCGAAGATTCTCGACTTT
TTGTGCAACGAGATTGAACAAGCGGCAGAAGTG