Description :
From Genome Similarity Track
Location :
Scaffold_213:28460- 31643
Sequence
3183 bases(100 bases per row)
CTAAGTCTTCCTCTGACTTAAGGAGCTGTGTAGCTCCGCTACACTTGGTAGCACTTGTAGTCAATCTACACCTGAGTCCTTTATGACTGATCCTCTGTGA
GGATGAAAACCCCCACTCCCCTTTCTGAGGCCCAAAAGGTCGCGCTTGATAAGCTGACCGCATTTTTGGGTCCAGATTATGTGGAATTCCTTGTATCGCA
AGCCCCGGCGGTGCTGACTGCACGTGTTGAGAGCTTCTTGCAGTATGAAGCGTCCATTCTAGGGCGGGTCCAAGACCAAATGGCGTTGGCTATGCCTACA
CGCTATGTGTCTGTTCCAGATGAAGAGGCTAGGCCTCGTCCACTTAGATTGGAAGTCAAAAACTACTCAGGAAAGGAGGATGATAACATTATCCTCTGGA
TCCGTGAGATTGAGATGGCTGTGAGATCAGGCCTGATCAAGCTTAACCATCAACAGGTCTCGATGGCTATCTCAAAGCTCGATGAAAGAGCTAGCGAATG
GGCCTTGGCGTAGCACGTCGGTCGACTTAGCGTTTCCCACATAGTCGCTTAAGTCACAATTGGTACAGGTGTTTTCACCACCTAACCAGGCTTACCGCGT
GCGTTCACGCTTTTTATAAACCCGTCAGGGTAAGAATGAGTTAACGGACTATGTCCAAGAGCTGGGAACTCTCATGGATGCTATGCAGTCTGACCCTCTG
CCTGAAGCAGTCCATGTGACTATATTTATGGAGGGTCTCCGTACTGGCATTGCCAGAATCAAAGTCTTTCGGGTTCACCCCTCTACATTCGAAGAGGCTG
TGATAATTGCTCTTAATGCTGAGCATAACTTCAAGTCGACCAGACTTGGCTGGAATGGGTACAACCCTAGCTCTGCGAGAGCAAACTCCACGAGTAGTCC
GGCCGGTAATAGGCCGGAACCGATGGATCTCAGCTATGCTGAAGACGAAGGTGAAGTTGAACTTCAAGCTGCTGAGCAGCAACGTGTTGTACGACGGTGT
TATACGTGCGGAAGTACTAAACACTTACGGCCTGGTTGCCCTTTGCATAAACAGCGCCAGGTTACGAGTCGACACTCTACCCCGAGCCAGAAGTCTGGCA
TGGCACGGGGAAATGCCGACACACAGTAGGCGCGAGGCGCCCTACTGGGGAAGAACTAGGTTCTGTAACACCTTTAGGAGGTAAAGTTGAACAGGGCTTA
GCCCCAAAGAGTTCCATACCTATTGGTTTGGAGCGTGGATAAAAGGTTAGCTTGTTGGTCGCTGAGGCGAAAGTTAAAGGCTTTGAAAAGCCTTGGTCTA
TTTTAATCGATTCTGGGGCGTCTTGCAGTTATGCTCGACGTCGTTCCCTTGAGGGAAGTCAGCTTTATGCTGAAGCGCTTACAGCGCATGAGGGTGATTC
AATCACGGTTCGTTTAGCGACTGGAAGTCGTTTCACTGTACCTAAAGTTCCTTTGAGATTAGGTATAAAGTTTTTGGACTTTGATAGCATTGAACGCTGT
CTTGTCCTTGATGTGGATTCGAGATATGATCTCATCCTAGGTATGGCTTGGCTTGAACGCCATGAGCCATGGATTGATTGGAGGTCGAAGACCTTAGGCG
CTACGCGCAATGTTCCTAGCGAAGCTTTGGAGAGTCATGAACCCACCTTTGCTAGGCAACAAAAGCACTATTGGCGTGAGCCTTTGATAGAAGATGTCAA
TGTGCTGGACATTGGAATGTCTGGGTTAACTAACTCCAATGTTGAAAACATGAATTCCGGGCGAAGCTCGTTGAGTATTAGTGATACGGCACGTACTTCA
TTGGGTGTTACCCGTTGTGATAACGAGTCACTGCATGCCGAAAGCATGGTTGGCCTAGGGCCGAGTTATCAAGGATGTGATTCCTCTGATGTGTGTGGGG
TGGCACGTGAAAACTCACCGAGGGCGGTCGGCCGTGAAGGCACCACACTTAATGTCGGTAATGACATTAGCTCTCGTATAGAGCGTACGACTACTAGTAG
TAACCACGGGGACACTATTGTCCCGACCCCAGAGGGGTGTAAGGTCTCATCGAAGAGACGACCGGGACGCCAGGTGGAAACTGTTAAGCGCCAGGCGTTC
GTGCAGTCACATAGTGACAATAGTGATGCACTATATACACTTGTCAACGGAGTGACTGGCCAGGTTGAGGGCAATGTTAGCCTGGAAACCCTTCCATCTT
TGGATGCTCTTTGTGAGCTAGACGAAATGTCTGATGGCGAGTTTAGCCAGTCCTTGAAGGCAGGAGATTTATCCGAATTAGTGGTCATTAGACCCGATGT
CGAGTTGAACTCGTCCTCATTAATGGATGAGTCGGTCCTAGAGGATACCAAGGCGGCACTCAGTGCCCGGAGTGGATCTTCGATCCTTAATGGTCCCTTG
GATCCATTCTATCCTTTGATAAGAAAATTTCAGGATGTGGTGTGTCACACAACCCACCATTTGTCTTACCTCCCGATAGAGGTGTACGTCATGAAATTGA
CCTAGTTCCAGGAACTAAATACTGCGTAACACGGAAGTGGTCTTTACCTGAAGAACAGTGTGACGTCATTAACGATTTCTTTCGTGCTAAGCACGCGGCG
GGAATGGTGCGAGAGAGTAAGTCTTCCCATTCCACACCTACGTTTTGTGTCAAAAAGCCTAGTGGTAAGTGGCGTATTGTGCACGCTTATAATAAGCTCA
ATGCCGCCACTATCCCGGCTCAGACACCAATCCCCAGAAAGGATGTTCTTCAGAACAATATGGTGGAATGTACATTGTACTATGCGCTCGACTTAGTCGA
TGGTTATTACCATCTGCTCATGCGAGCAAGCGATAATCCGCTAACAGCGATTAGTACCCCAAGCGGTATGCTCTGGGAGTGGCTCGTTATGCCACAGGGG
CTATTAAATGCCCCGGCTACTTTTAACCGTCTGTTGACGCAACTATTCAAACCTCATGGAGGCTATGCACAAACGTACTTTGATGACATCTTTGTCCGTA
GTCGTGCAACGAACGGTCGATCTGATGTGGATAATCACACTGATCATTTACGAGCGGTGCTCGAGTGCATGCACACGAACAAATTGTATGCAAATGCATC
TTTGGTGCAGAAGAGATTCCCTTTCTGGAGTGCTTCATTGGGAAGCGAGGCCTTCGAGCGGACCCCGCTAAGATAAAGGCCAT