Description :
From Genome Similarity Track
Location :
Scaffold_2273:2846- 4189
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_2273-fgenesh-gene-0.1Glutathione S-transferase

Sequence
1343 bases(100 bases per row)
GTATGCGGCTACGCCGGCGTTCGCCTTGACGCTGTCAGCGACAGGGCGCAGCTTTGGGTACGGCGACGCGTCAAAGTCTGGGAAGTTGGTCTGCAACCCA
TTCACGAGTACGTCGAAGAACTGGACGTCGACGTACGACATCTTGTCGTCGCCCAGGGAGAACTTGCCAGCGACGAAGCCTTCGAGCGCGGTCAGCGCCT
TTGGCACATGCTCCGCGAGCATCGCCTTGGTCTTCTCGGCCTTCACCGCGGGGTCCCGCTCGAGGTACACAATGGGAAAGTACACGGAGGCCAAGTCCTT
GAGCGTCTCTGAGATCATGTCGGCGCGCAGCGCGTCGACGGCGTCCACTGGGTAGAGGCCGACGAGCTTGGCGACGTAGCGCGTGATCGCCATGCTCTGC
GCGTAGGTCGTGCCGTCCACCTGGAGCACGGGGAGTTGACCAATCGGCAGCGATGGCTTGAGCGCAGCGAGGTCGCCAAACGAGATGCGCTCATCGTCGA
ACGCGACGCCGCCGTAGTGGAGGAGGAGGCGCGCGAGCTCGGCGCGGCCAGTGCCGTCGAAGTACGTGAGCTTGAGCTGTGGCATGGTGGCTTGTACAGT
AGAATTGGTGGTCGTGGGTCTTGAGCGCGATACGGGAAGATCCAGAATGACATCGTGGTGCGATAATAATCCGACTATCCTTATCTAGTTCGCTGCATCA
TGGGAACAACGAGTTCCCAACGATTTACTGCATAATCACTGATTACATACTTGTTGGTGTATATCGTGAAAGGCTTTCCGTCAAAACGAGTGCATTGCCA
GTCGCGCGAGCTCCAATCGGCTCGACGTACCGCTTTACGACTCGCGCGTCAAGATGGGGCCATGCTCTTCACGATCCTCGATACTGAGCTGCACGGCTTA
CAACCAACTGAAAATTGCAATCAGCCTAACATCAAGTCCACTTTGAAAGTTGATGCGTCCACTTTGAAAAGGTAGCATTTTCTTTTTTTTCTTGAAATGT
ATGTGATACTATTTAAGAAATGTGATGCTAGCACAGAAATGACATACGATTATGACGACTATAAATGTGTGTCGCACAAATTTATTGCGGATACAAAATA
TTTGTTCAACAATTGCGGAGTTATTCAATAATTCCACAAAATGTAATTTTTAAGTGGGTACAAACGAATGCATAAACAATGATTACACCCTTGTTTTTGG
GTACATGTACAGGTCCTGTACCCACCGGTCCACGAAGTCTGCTGTTCACAAATCCAAATGCCATTCGGCAACATGAGCGGCACCAACTTGTTCGCGCCCG
TAATGCTGGGCGTGGTGCTCTGCCTCATCATTGCCTTCTGCTG