Description :
From Genome Similarity Track
Location :
Scaffold_33:284507- 286540
Sequence
2033 bases(100 bases per row)
acagcggtggtatcatatccataagcattacaacaaggctaggaatcaagtgaaCACCCGACTGAGTGAACGGATAGCGACCGACTGGTGCAATGGTGAA
GTCTGATCGCATCCGATAGAGACTGGATTCCAGtcgactcgtccttcatgttcaccagcatttctccggttcttttgaataacgccgtacgggatgtcag
ggcagcaagcccagtcagttttttttttcattttgtagtgaatttgttgccgttggtcactgagccgtgcacacagcggaaccacaggtgcacacgtgtg
gatttatcagaatcgcgtgaagaaaggttacgctcggaagctaggtcccctgtggcTTTAtgtagtgggtctaacttgactcactactttagcttacacg
ttgcgcaacgtgtatgaggaagcgtaagtacttagtaattacttaggttaattatatttgaatacacaaatataattttaatcagataagactccaagtc
gctagtttatggtaaaatgagaacagtattgtttgtaaattgatcttcctcctaaaactgctaaaactgtttatcatctatgaaaggggttggtagcggc
tggctgtcagagccccgctaatatacatgtctctgattggtagaaatacgctgctttctaccaataggatctttgggtaggtgtggaccactcattgtag
tggcccacttcaatgtatccattggtgtggcatacaccaaggtgaggaagtatctaaaattttaacagatatcctatctgttaaattcacaagtggcttg
tagccacttgtacgtgtaaccccgttacacttgacccccttcgtgtcacggagtgtattaacggatacacgttagaaatgcaggccaatgggtcggatta
ccgtttgtttccgatcgtacatatgacgatactgaaaccagtcggaagcttcgccgatcggatacagatcgagatcactgtggtcgaagtcgatcgattg
gatatttacgaagtcctgtcgccagttactagttgggctccaggtcggggtgagaatgattatggggtggagaatgtcacgaatatgagaactagcggaa
gaacgcggaacgggcgggcctattgggtatttctggtgttctgaaaaggttacgacgatccagactgggttgatgaagacgatctcaattgcggagctat
gttacatgagtttcttcgcaatcgggcaacccgaaaacgtttcggtgcgatgcagtctcatgaggaggagtgagattaggtcataaaggcgggttggccg
ttctggtggGCGTGATtgtcgtgtaggaacacgcgctaaattatatatggcacactttccccaccaacaacacccaccaagtcaccgaagactcaatggg
cttgttagggttagaacctgaaggcccaggaactttcccttgcaccgggttgatgtttcctctgtgcaccgagctttcgctagtcgaccgacggaagact
cagcgtcactagccacgagcaaaggctagcacgctctcacacacaaaataNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN