Description :
From Genome Similarity Track
Location :
scaffold_1421:2843- 3955
Transcript NameFunction/comments
g11398.t1 abc transporter

Sequence
1112 bases(100 bases per row)
AAGAAGACCATTCTGGACAATGTCAGCGGCCGGTGCGCGCCCGGGGAGCTCACGGCCATCATGGGACCGTCCGGTTCGGGGAAAACCACGCTCGTCGACC
TGCTGGCCGACCGCATCAGCTCCGGAGACGTGACGGGCGACATCGAGCTCAACGGTGAGGCGCGCGTGTCCAAGACGTTCCGGGCCGTGACCAGCTACGT
GGCTCAGGAGGACTCGCTGCTCGGCTCCTTCACCGTGCTGGAGACCATGCGGATGGCGGCCAAGCTCAGTCTGCCCAACAGCGTCACGTCCAAGCAGATC
GAGGCCCGCGTGGACGACGTGGTGGAGGCCATGGGACTGGCCACGTGCCGCCACACGCTGGTGGGCGACATCTTCCGCAAGGGCCTGTCGGGCGGCCAGA
AGCGCCGCCTCAGCATCGCCATTGAACTGCTGTCGAACCCGAGCATCCTCATCCTGGACGAACCCACGAGCGGCCTGGACTCGAGCGCCACGCACAACGT
CATGAAGTTCATCGTGAAGCTCTGCGCCGAGGGGAAGACCATCGTGTGCACGATCCACCAGCCGTCGTCTCTGGTCTACGACATGTTCACGAACGTCGTG
GTGCTGTCGGCCGGTCAAACCGTGTACTGCGGCTCCCGTCGCCAGATGATCCCGCACTTCGCGTCCACGGGCTACGACTGTCCGCAGTACATGAACCCGG
CCGAGTACTTTATCAGTCTGGTGAACACGGACTTCGACGACCACGCAGACGTCCCCAAGCTGGTGCAGTCGTACGCGCAGAGCGAGATCCACAAGGAGCT
GAGCAACCGCATCGAGAGCGACCGCAAGACGCTGCAGCACCTGCCGGACATCGAGCAGCCGTCGCCGTCGTCGCTGCGCCAGTTCGGCGTGCTCATGTAC
CGCAACACGTTGAACAACATCCGCAACCCGGGGATCTACTGGATCCGGTTGTTCATGTACTTCTGTCTGAGCTTCATGGTCGGAACCATGTACTTGAGCA
CGAACGACGACCTGACGGAGGAGGACCTGATCCCGATGCTGTTCTACGTGCAGGCGTTCCTGGTGTTCATGTCGGTGGCTGTTCTACCGTTCTTCATCGA
GCAACGCGCCGT