Description :
From Genome Similarity Track
Location :
Scaffold_128:28422- 32320
Sequence
3898 bases(100 bases per row)
GAGACATTGAATGTCCTGGTTACTGACGGGTCAAGTATAGGAATTCATACGCTTGATCTGATAACGCCTCGGAAGTTGACTTCGTAAATCACTCATTTAC
CCCCGCTGAACCAAAATAGGTTCTTACGTGATCTGCGTAGTGGAAAAGTCAAGCAGATCTGGGTACTCGTCGCAGAAGACGAGTACGTGACCGACATCCG
GTCGGCAGTTGTGTTCGCCGAGAACGAATGGGTTCTTAGCAGCTCATCGATAGACGAAGGTGTAATTGATGAGAAGGCTCGGATTGAGCGATACACATCC
CAATCGTGGGAATCGCTCAAAGCAAATCCTGTCTACGATGATTTGGTGGAAATCAGAGATGTATTCCCATAAGCAGTGTCGTGCGGGTTACCTAAGGACA
AAGGTGTTTGTCACGAAATCGACCTCAAACCGGGTTCGAAGTACTGTGTCATGAAGCAATGGCCATTGCCTCGTGAACAAGTACTAGTGATCGACAAGTT
CTTTGCAGATCGCTTAGCAGCCGGACATGTGAGGGAGTCGACCTCCCCATATAGCTCTCCGACTTTCTGTGTGCGAAAAGCCACAGGAAGGGGGCGGATA
GAACATGCATTCAACAAGTTGAATGCTGCAACGGTACCGGCGTAGACGCCGATACCGAGGAAGGACGCCACCATTGATGGTATGGCGAAAGGTACCATCT
TTTTGTCCATGGATCGGACGGATAAATTCTATCAGATCCTTATGCGCGAAAGAGACATTCCCTATACTGTAGTGAGCACCCCAAGCGGTATGCTTTGGGA
TTGGTTAGTAATGCCACAAGGGCTAAGTAAAGCCCCTGCCACATTCAACAGCTGTGTAACGAATCTATCAAGAACCGTAAGAGAGTTTGCGCCCAGCTAC
TTCTATGATATGTTCTTCCATAGCCGGGCTATGGACGGACAGACGGATGTGGAGGTCAACGACTCCACGTCCGGAAGGATCTTACACTAATGCGCAAGCA
TAAGTTGTACGCCAACCTCAAGAAGTGTATATTCGATGCTAGCGAAATAACACTTCTTGGTTGCATCATGGGTAAGCATGGCGTGTGACCCGATCCAGAA
AAGATCAAGGCGATCACCGACCAGCCGGTGCCTACACATGTCAAGGGAATTTGGAATGGCCTAGCGGCGTATTTGCACAAATATTCACGCAATTGCGCCG
AGATGACTGTTCATCTCTCTCGTTTTTTGAAAAAGAACGAAAAGTGGGTATGGAGTGCCGACAGCCAGCTCTCTTTCGAAGGTATCAAGGAAAGCTTGAC
ACAATAGCCAGTTTTGGCGATTGTAGACCTGTACAGTCCATTCCATGCGGTATGTGGCGCCAGTGACTTTGTAGTCGTCTGTGCGTTAATGCAGTACGAT
GCAGACGGTGCGGAACGTGTCGTCTGTTATCAGTCACGCCATCTGCAACCAGCTGAACGTAACTACCCCGTCCATGACAAGGAACTCCTTGCCATTGAAG
TACGCTCTGGCTAAATTCAGAGTTTATCTGTTCGGCGATAGTCCCTTCATTGTTTACACGAACCATGCGTCTGTACGCACGGCCGTAAACAGTCCACATC
TCTTGCAGCGGATGACGAGGTGGCTGTCATTCTTTGCGGGGAACAACGTCTCCGTCGGGTATAAGCCAGGACGACTTAATGTCGTCGCTGAAGCACTCTC
GCGCCGGCCCGATTTCGAGCCGGCTGCGCCACCCGAGACTGTTCCGACCACTGTTGCGGTACTGACTTCGAGTGTTCCGTCGTCAACCTTATTGTCCGAC
ATACGAAAGGCGTATAATCCGGGGATGGTGTGATTGCTGCATCATCACTCGCAACTATGGGGAAAGCCTTAAACAGTTGTCGTCAGTATATCGATCCTCT
ACGGATAGATATATAGTTCGCAACGGCTTACTCCAATATTCGGCTGTTGCCGGCGACACACCTCGTGTCGTCGTACCAGATCATGGTGATCTGCAATTGC
GTATCATGTATGAGTACCACGACGCACCTGTTGGTGGACATCGTGGTCGTGAAAAAACATATCTCACAGTGAGCTGCGACTTTTACTGGCCCCGCCAGTA
TCAGTTCGTGCGCAAGTACGTTTGGGCCTATGAGGTCTATCAACGGGTGAAGACTAATCCTTCCCTTCTAACCATGTTGCAGCCTCTGCCCATCCCGGAC
GAGTGCTGGGAATCTGTCTCAATGGACTTTGTCTTCGGATTCCCCGCAGACTCTCACATGAATACTGGTATTCTAGTGCTTTTTGACAGATTCAGCAAGA
TGGTACATCTGGTTGCTGTACCTGAATCAATCAACCCAACGGCTTCTGCTCGTGTCTTTATCGACACGGTCTTCCGTCTTCATGGGTTGCCTCGTGAACT
CTTGTCCGATCTGGACCCGCGGTTCACCGCCGAGTCTGGAGGTCCGTGTTCAAAACACTCCGAACGCGCTTAAAGATGTTCACGTCTGACCATCCTGAAA
CAGATGGTCAGACAGAACGCGCCAATCGTGTCCTCGAGGAGATCATTCGAGGGTACGTCCATTCTGTTACGAATTGGAGCGTATTCTTGCCGATGGTGGA
GTTCGCCATCAACAATTCAGTCCATGCGTCGACGACGCACACGCCGTTCTTCGTGAATGGCTTACGCCATCTTCGTCTTTCCACCTTTTAGAGTGTGAAT
CTCGTTTAAGGGGAGAAGGGACTCATTCGAGCGACCGTCAATCCGGCTCTCACTCGTCACGTGCTGACAATGCGGTCACCACGTTCGACGCCGATGTAGA
TCACATCGTCTTCGGTGAAGAAGACGAAAGTAAGAGCGACGATGCTCTTAATGGCCACGATACTGATCAAATCAGCATCACTACCAGTGCTTCCGAAGAC
ACACTCACAGAAGCAACAACTGATCTTGCCGTAGTGCACTCCAAGAGCACTGTAGCCAAATGCAGCGAGTCAGCAGATGAATTCACACTGGCTCGCGAAA
CGGTTGTGCGTTTCGTACAAGACTCTATCGCAAAGAGGTAGATCGATAAAAAGAAACGCTGACAAGAATGGAACGGTAAATGTTCTTTTATTCATTAAAG
GCGACTTAGTCCTACTATCCACGGTAAACCTACCTTGACACATAGTGACTAACGTGAGTAAGTGACAAGTTACTACTCAGTTCATCGGTTCATCTCGTGT
GCTGCTCCGCCTAGGCAACGCTTACACGATGAGCTACCACGTAAGATGCGCACGCATCCTACGTTCTACGTCGGGTCGCCTTCGACCGNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCGAGGTCCTCGCGAAACTCACACG