Description :
From Genome Similarity Track
Location :
Scaffold_65:284213- 292638
Transcript NameFunction/comments
Physo_138659hypothetical protein
Physo_138660hypothetical protein
Physo_138661OSJNBa0065J03.2

Sequence
8425 bases(100 bases per row)
CTGATATCAATTTCTAATGCATACCATCAAAATCCCAATTTTGGGATTTTCAAGTATTGCAGTAGCAAACTCCTGTCTATCTCAGGTGAAGTGCCAATAT
CCTGCAGCAGACACTCGAACGGACGGCGTGAACTTGGACAAGACGCCGTGGTAGCTCGTACTGCAGATCGCGGCTGTCACATTCCCGCGGTAGGCTTCCT
GGGCTGCAGTGTACGCCGCGTTGATTTCCGGGGTGCTGTACTTCTCGTTCTGGTAAATGATCGACTTTTTCGCCGTGGACGCGGGGCATTGGCCGATTAG
ATCCAGCACCCCGGCGACAATTTTCGTGAATTCACCGTCGCACAGGTCTCGTATGAAGTCTCCGGCCATACTTCCCATCATCGGAGCGCTCAGACTGACC
CACGACGTGCTTTCGGCGAATTTACACTTGCCTTTCGCGAGAGCTGCCGCCATCACGAGGCCGCCCATCGAGTGCGTCACCACGATAGTATCCGCAATGG
TCCCCGTGGCCACGTCGCTAGACTCGCTCATGGAGAGCGAGAAGTCACAGAACTTCTGCTGCAGTGTGTCATTCCTCCACCCAGCGTCGACGGTATTAAT
GACTGCGTACTTGACACTGGTGCAGCACGGAGCGTGGTCTCCGATGATACCGAACTTCTCCTGGGTCAACTTTGGAGTATCTTGCAGCTCCGCTCTTTCA
TTCGAGGTACCCAGACCATGCAAGAAGACGCAGGGACGAGGTATTGACTTACACGTACACGATTTGGCCTCAATAGCCATGGGAGCAGATGCTTTCAAGC
GCCTCGATGTAGCCGTGGGAAGTGAGCTGCCAGTGAGTATCGCGCGTGTTGTCGGCGCCACTTTTGTGGGCATTGCTACACTATCACACGGTGGTGACCC
ATCGGTGAGCTTTGGCACCGAAATGCTGACGGGATTCTGCAGGTACTCCACGTCAAGTGTCAAGTCGAGGCCCGTCGCGGTGAACCCGGACGAACCCGAA
GCGCAGACGGCGAAAATCGCGTCATGATACGAGGTCTTGAACAGGTTGTCACTCGCGCAGTCGACACTGGCGTTGCCTATCAAAGCGCTGGGAATCGGCA
CCACATCGTTCAGCGCCGGCAAGACCGAGTCGAGCGACAGCGCTCTGTCGCGAGTCGCTTTGTCGGACCGGTTTGGGGCCGATCGCCGCTGTGAGTAAGT
GCTGCCTGTGCTTATAGGTTTATGGGGCACAAATAGCAAGGAGATCACTAAGCAAAATGCAATAAGTGTTCCATACGACCTGTGTGGTCCTTTTAAACAA
AATTCACGACTGACCTTCCTTCTACTCCTAACTTTCCTCTCAAAGCCACCCAACATGCCATCCGTCCCCGAAGTCCCGCCACGACACTGCGAGGCACATC
ATCCCTCCAAGATACCTCTGGGTAGCGGCCCACGGGTCTCCACCTTCGAGACAACCCGGCCCACGGCCCACTACTTCTCGCCCGCGGCCACAGCAGGTGG
ACGACCTCAGGCACTCATCGTCGCCCACGCAGAGTTGGAACGGTCCGAGCCGTTCCGACTCGGGACATCCTCCCCGACTGCATCTCGGCGTCCTCGCCGA
GCGCACGCAGCTTGATCCACTTCTCTCCTTACTTGCCAGGCCCTCCGTTCGGCCTGCAATCCACTTCGCGTCCACACCTACACTCTCGGCGCATTGCCCC
CGCCGTCCATCCTCCAAAATGCCTCACTTAGACGCTCTGCCTGCTCTTGCTCCTCAAGAGCCGCGCACCACGCAGCGTAGCCCTCCGTGGCCATAGTCAG
CGGCGAACGCTCGCCCACCGACGCCTCGTACTACCTCCACAACTTACTGGTTATGCATACCAGCGCAACCCAAACATTCACCACCAGCAACCAGTAGTTA
GTCACTATTGCATGCTCGCCCTCCTCGGAGGCGAACCAGCAATCAAAGACCACGACTACAGCGAACACGCCGGCCACGCCCTGGCAGATCCACTCGACGA
CTTCGTAGGTGAACAGCACGGCGTAGAACGCCGAGAACAGGATCAGGGACGTCAGCGTCCATACCACCTTGGCGACAAGCTTGGCACGGGCGACCGAACG
GCCAGACTCCAGACTCGCGCCCGTGCAGTACTTGGAGCAAGCCTTCCGTCCCGACGCCCAAGTCTCAGGCAAGAAGACGCACCACCACTCGTGGAGGGCG
TCAAGCCACTTGTAGAGCAACCTCCCCAGCCCGTCTTCATGCTCGCCCTTGGATTCCAGCACAACCAACGGGGTGGCCAGCAGGGCCTCGTAACACTTCC
ACACGCGAGTTCGGAGCGGCTGCATTTGCACGGCAGGCCCACGGACATACCTGCAGTAGCGCATGACGCATAACTTGGCCAGCACGCTCCACCTCAGGGC
GAAGTCGACGAACGCAGCGGCGATCCGTGAGCCGATGCTTCGCAGGGGGCCCGTAACCGTCCACGACACTGCTCCAGCAGTGAGCCACGCCAGCTCCCAG
CGACGCTCCGCTGCAACTTGACAAGCTGCCTCAGCAGCGACCACCACTATTGCCGCCAGGCCGTTCACCACGTCCGTCGCCCACTCCATCGTTCCAGCAG
CACTAATTCATAATGACGGCCACTTCGACGCCGTCCGAGCCGTCCGGACCCCACTAGCGGCAGCCCTTGGCGGTCACCATCGACCTGCAGAGGCGCAGGG
CAGCCAAGGCCCCGTTACTGCCAGTTGGTCACCAGCGTCGCTCGCGGGTTCTTCGAAAGTGACCAGCCAGTTGGGCGTCTCTCTCAGACGGTCACAGCCA
CCCACAAGGTGAGTCACATTTCGTCAATTCACTTGAAGTCACGTGGTAATCAGAAGTTGCCGTAGCCGCCCCACTGAAAGTTGCCTCATTCCGCAATTTT
CGCCGGGCCGCGCACTCCGCAGTCACCAAGAATCTCTCCGCTCTCTCCCAGGCCTCGCCTCGCCTCGCGTCCGTCATGGTCAAGAAGACCAACTCCGACG
TCACCGACTTCGATAACCAGGTGGGCAGCCTGGACATGGCCCTCGAGCTCGACGACGAGGGGGACGTCTTCATCGCGCAGCGCGAGTTTTGGGCGCGCCT
CCGGACCCGTCTCTCCGTCAACAATGCGTCCCAGGGGCTAGACGTCCTGGACGCCATGGCCATGGACGTCCTGTCGGGTGGCGACGCACGCCGCCTGAAC
CAGATCCTCGTGATCCTGCCGCACCCCGACCAGATGCAGGCCGGCGAGCCTGCCGAGCACTCCGTCCTGTCGATCCCGCTGCCGCCGTTGGTGCCCACGC
CAGAGTCGACGTCACCGCCACCGCGTCCATCGACAGGGACCAGATCGTCGCCACGGACGTCTTCCAAGACGAGACCGCCATCGTAGAAGAAACAGAAGGC
CGCGGCCAAGAAGAAGGCCGAGGCCTACGACTTCCGGTTGCCGACGACGGCGCCCGCGCGACTGAAGATCGACCTGGCCGCACTTGCGCAGCGCGCCTTC
AGCAAGGGCATCGCTCCGTTCCGCTTGGCGTACCCCTGGCGCAAACAGCGGTGCTGGTACCCGCCATCCGAGTATCCCGAGTTGCACCTCGTGCCAACAT
GCGCTTCCGCGAGCTGTTTTTCCTGTGGGCGCTGTACGCGCCTTGTCTGAATGCCGACCAGCGGCGCAAGGAGAAAATGAATGCGTGTCGAGCGCGGAAC
GAGCTCATTAGCTACAACATCGAGGAGCGAGGGTACTTCGGCTTTCTCGACGACTTCGAGAACGGTGCTCATGACACGCTCATGTGGTTGGGAGGCAGAA
CGGCCAAGCACTCTGCCGGCGCGGCTAAGAGCAAGGGCGCGGCGCACGAGGACCTCGGCGTTGTCTTCGCAAAGGACAAGATTCTCTACGAGCGGGCCAT
CGAGCGAGCTCTCGACCCCAAGATCGTCGACGAACACGGCTACGCCTCGATTCTGGAGCTCCTCGAGGAGGCGGAGCTCATCGACCCCACGCAAGCGCCA
CACCTGCGAGTCTCCGACAAGGCCCTCGCTCGCATCAAGCTCGACGTCACCAGCGGGCCACCCCCCGTGGGCAACCGAACCCGCGGCCCGTGGAAGGCCC
TCTCGTCGGACGCGTCGCTCAAAGATACCATCGAGGAGGTGGTCGAGCTACTGGACTTGGGCATGAAGGTGGCCGTGTACGACCAGAAGCCCTTCAACCC
CGACGAGCAGGGCGACGATGACTCGGACTTCGAGGACGAGGACGGAGCCTTCACGGCGTTGCCTCCGACGCCCCCCCGTGCAGTACCGGGCTCCCGCCGT
CAAACACTCCGTCCAAGCCAGGATTTCCGGTTTCTCGCTCCAGCAAGTCAGGCGAGTCCGAAGACTCCAGCGACGACAAGAAGAAGCCGGCGGCCAAGGA
CGACAGCGACAAGGACGACAAGGCCCAACCCAAGACCACCAAGGCCCCCGTCGCGGCCATAGAGACGCTGCCGGGCGACGAAGCAGACGACGACGGCGAG
GTAGCGAGCGAGCCTCCGACCAAGAAGCTCAAGTCGCATTCCGCAAGCGTCGACAAGGCCAAGTGAGTCATGCGCACACCTCGGATCTCCATTTATCTTC
TTCATTTGTTGTAGTCGAGTCTAGTGCAGCCGCAGCACTAATTTTGCAGGTAAAACCAAATAAAAACATGAACTTGACATGCATATCCACCATTCTTGAG
CTGCTCGTAAATCCATATCCACAATCACAGGTTCTTCAGCTCAAGAACATCATCAACTACGCCAGCAGCAACTAGTCATCATCGACTTGGGCGTTAGCGT
CCGCCAAACGCGCACTTCGACTAAGCTCCGGCAACCCCTTCTTCCTCCTATCCGCTTGCTCAAAAGTGGTCACCAACGACGCATACTCGGGCATCAAAGC
CTCCCTGGGCAGCCAGAACACCTCATACGAGCTGGTCATCGTCAGGTACTTCACGCCCTGACCGTCCTTCATCTTCGCCACTATTCCACGATGGGGGCTT
CCACGCCCACAATAACAGTGTCCTCATTTCCTAGTGTCAACCGTTCCGCGTAGCTCGACGCAGGGAGGTCGGCCTCTTCCAACGGCCTCTCTTCTTCGTT
TTCATCACTAGTGCCCAGACCCTCGGGCACTTCATCCATATAAGGCCGGGTCCACTTGCCACGATACCTTTTGAGCCTATTCACGTTCACGGTCACCGTT
TTGTTAGGGTGAGTCGGGATGTCGACCCGATAAGCGTTCTCGCCGACCTTGGCTACGATCCGATAGGGACCGTGCCAAGCGAAGGCAAGCTTCTTCGTGC
GCACTTCGCCGCGTTTCGCCCTGAACACCTGGTAGACCCACACCGGGTCTCCTATTTCATAATTCACTTCGACTTGCCCTTCCGGGCGCTGCTCGTGCCG
ATCTTGCGCCTTCAACAACTGACGCTCAACCAAATGTCGCGAGGAACGGAGAGCTGTACAGCTCTCGCCTATACTGAGCCACTTCATTACTCCGCCACTT
CTTGCCAAGATTGAGGAAGGCCACGTCCGTCGGAAGCACTGGGTCGCGCCCGTACAGCGAGAAAAACGGCGAATCTCCCAGGGCCTCGTGGTAGGCCGTC
CTGTAGGCAAAAAGCACTCTAGGAAGGTAAATATCCTAATCATCTTGAGCCTCACTCACATGCATTCGTAGCATTCCTATGAGCGTTCCGTTGAATCTCT
CGACGAGTCCTTGAGTCTGAGGGTGGTAGGCAGCACCAAAGAGTTTCTTAATGCCCAACATCTGATAGAAGGACTTGGCCACCTCAAAGGTGAAGTTCGA
GCCGTTGTCGCTCAGCAACCGCGACGGCACTCCGTGCCGAGACACCACTCCGTTCACCATCACCTCCACGAACGTCATGGAGTCCAAGCGCTCCACGGCG
AACGCCTCGGCCCGGCGAGTGAAGTAATCAACGAAAACTAAAATATAGCGATTGCCACGCTCGGTTTCGGGCAGAGGCCCCACGGCGTCCACCACGAGCA
ACGAGAACGGCCCCGTCAGATCCACGATGGGCATCCTCTGCATTCGACCAGCGCGCCACGGACGCGCACCCTTGCCACTTCCGCACTTATCACATTCGCG
CAAATACTCCTCCACGTCCTGTCGCCACCCTGGCCAGTACGCGTGTCGCCTCACCTTCTCGAGCGTCTTCGTGAGGCCGAGGTGCGACGACAGTAGATCA
GCGTGACAAAAATGTAAGACTGTTTCAACGAACGGAAGCGGTATCACGGGCACGGTCAGCGATCGAGCGGGACCGACGCGCGCGCGGAGATTCACTCTGC
GCATCAACAGCTCGTTCTCGACGGCGAACTTGGACGCGATCCTCACAACCTTCACTCGTAAGCTAGGGTCCAGCGGCAGCGTTCCACCCGTCAGGAACGC
GATCAGGGCCATCACCCACGGGATCTTCCGCTGCTCCACCTTCAACTGCTCCATATCGAGTCCGAACAAGTCCACGGACGACGGAGGGACGTCCGTCGGC
GAGGAATCGTCCTCAGTAGCGTCTTCCGGCAACGGAACCGCGGTCTCCGTGCCCATCTCGCCGCCGCCGTCTCTAGTCATCGGTTCGGGCGCCACGTTGG
ACGGCTCTCCGACTGAGTCGTTGGCCACGGTCTCGGGCGAGTCGTCCGGATTCAGCAAGTCGGCCATGCCCACAGGCGAGCCCCCCGGGTTCAGGAGGCC
CGCCATGGTCAGCGCGTTCACACTCGCGGTAGGGAGGCGCGACAAGCCGTCCACGTGCCCCATGCTCGTCCCGGGTTGTGATGCACTCGGAATTGTAGAT
TGGATAGCTCGATCGCCCAGCGAGCGAGCTTAGCATTGGTCGTGCGGTTGCCAGGACTGAAGACACAGGTAAGCGCCTGATGGTTAATGTAGAGATCAAA
CTCTCGCTTATCTAGGTAGCAGCGGAACTTCCGCGTAGACCAGACAATGTCCCAGCATTCAATTTCAGAGATTCCGTCTTGGTTGTTGATCCAGTTCTTC
TGAGAGCCTGTCAGTAACTTGCTAGCATAGGCGACAGCACGGTCTCGACCGTCCACCACCTGCATTAGACAAGCACCGACAGCATACCTCGACGAGTCGA
CGTAAAGCTTGAATCGTTTCTTCATGTCCGGGTAGACTAGGATAGGAGGAGTGACTAGCGCCCTTTTCAGCTGGCGGAACGCCACCTCACAGTCCTCGTT
CCAGACGAACGGAGTGTCTTTCATTTTCAGGCGTTCCAGCGGCGTAGAGATCAGAGCGTACCCCGGGATATACCGGCGGAAGTAGCTCGTCAGCCCCAAA
AATGAACGGATATCATGCACATCGCGCGGCCTCTGCACGTTCATGACGGCCTTCACCTTCTCGGGGTTCGGGAGGATGCCCATGGGTGTCACAATGTGCC
CGAGAAAGGTGACCTGACTCCTGCCCCAGTGGCATTTCTTCATCTTCAGTTTGAAGCCGGCCTGTTGAAAGCGGGTCAGCACTTGCCGAAGGCGAACGAG
GTGCGACGGGAAGTCCTCGCTGAAGATGACGCAGTCGTCCAAGTACACCAAGCACACGCGCCTCTTGAGGTCGACAAGCACGGTCTCCATCAACTGTTCG
AAAGCAGGTACAACATTGCATAGGCCAAAGGGCATGACTAACCATTCGAATAGACCGTATTTGCATGTGAAAGCCGGTTTAGCAATACTGTCTGCATGCA
TGGGCACGTTCCAGTAGCCTGAGGCGATGTCCATGGTCGAGAACAGTTTGGCTCCACTCAGCACGTCCATGATGTCGTCAATCAGCGGCATAGGATAGCA
ATCTTTGACCGTTACGGCGTTCAACTTCCGATAATCGATGCAGAAACGGATGTCCCCGTCGGGCTTCCTGATCATCAACACGGAGCTGGCCCAGGGGCTG
TTCGAGGGCCGGACGAAGCCCAGCTTCTGGTACTGCTGGATCTCCGCCTCCATCACCTCGCCCTCGGCGAACGACACGTGGTAGGGCTGCTGCTTGATCG
GCTTGCTGTCCCCAATATCAATCTGGAACTTCAGCAAGTCGGTCCTGCCGGGCGAGTTGGGCGACTCCACGAACATGTCTCGGAAGCGCTCCAGCTCGCT
GCGGAACAGCGACTTCTGCTCATCCGACAGCCTCGACTGGGAGAAGTCGGCCTCGAGCGCCACCTCCTTGTCGGGCGGCACATCGGGCCTCGACGCCCTC
ACAGTCTTGCCGAGATCCGGCCCCTTTGCCTCTTCTTCACGACTGGCAGCAACGGTGGCCGCCCCGCTAGTCTCGGGCGGACGGCAGGCGCCTCTTCGGA
CTTCTCCGCCGACGGCTGCTCAAAGCCGAACGCCGACTCGGGCACCACGGACGTCGAGGCCACCACCGTGCCCTTCTTGATCCAGAACTCTTCTGTCGAT
GCGTTGCAGACCTCCACGACGACTC