Description :
From Genome Similarity Track
Location :
Scaffold_197:28412- 32809
Transcript NameFunction/comments
Physo_144548hypothetical protein

Sequence
4397 bases(100 bases per row)
CTCGCACGCCGCCCTTGTCCAGTGGCGCAAGGAACGGAAGGTCTATGAAGACATCATGAGAGCGCGCTGCCAGACCTCGGGAGAGGACTACGCTGCGGTG
ACGAGATCCGTGAAGGATTCTTTCGATCGGAAGCTGCTAGAGACATGGTGTCGGCTCCGGTGGCAAGTTGCAGTGACTGAAGTCGATGACGACAGACTGC
GTAGCGAGATCGACAACATTATCAACTCCGTGAAGAACCACACTCTGCCCGACGTGCAAGCTCTGTTCAAGAAAGAGTTGCATTTCAACCTGAAGGCGAG
TGACGTTAGCGAGCGAGTGCTGCAATATTTCATCTCCTGCGAGCGCATAATTGAAGAACACGGCCTGCATGCCTGTTTTGAGTCGGAAACCGGGCGGAAA
GAAAAATGCAGTTTGCTGGTCAACTCGATTACCCCGGAAGGATTGAAGGAGGAGGTGAAAAACGCCTTGCGGTACCAATCGCCTGGAGCCAAGACGGATG
AGTGCAAGTTGCACGATGTGATACTGGCCAAGGCACTTGAGCAGGACCGAGACTTTCGGCGATCAAAGAAGAAGAGGGTCTCGGATGATGTTCAAACGCC
ACGTCAGACACACGAGCGCGGCGGAAAGAAGGCCAAGCTCAGAGCCGAGTCTGGCGTGCACGGACAGCGAAAAAACCATGACTCACGCAAGAAAGAAGGT
GCTCCTGCGCGAAATCAACCACGTCCGGAGGCAAAAGGAAAACCTACTGCTACCGCACCGAAGAAAGGATGCCTAAAATGCGGAGGACCTCATTGGTTTT
CTAAGTGCCCTGAAGCCAGTGACGCTGAGAAGCGAGAATTGCCGAAGCAGTTCTACAAGAACAAGGACAAAGCGTCCAGCGATGTGAACATGAAGCGACT
TCGCGAGGAAAACTGAAATAAGGCGGGCACCGTTCTGCTGAATGGTGTCCTCCGAAAGCCTTACTGCGCAGATACTGGGTCGAGTCGGTGTCTCATCAAC
GTCAAGACGCTAGCAGAGCTCAACGCAGTAATGGGGAAAGAGATCTCGATAAGGAAACGGGAAAAACCGATCAAGGGCCGTGCAGTTGGGGGGCATTGGG
TCGAGGCTGTGAAAGCTGTAGACCTGGTCATCCAAATTGGCACAGCCGCTGGCATCGTTGAACACCAGAAACCTGTCGAGTGTCTGCTAATTGAAGATGA
TGATGATGAATTTATCGTGGGTAAGGACTTGTTGAAGTCATTGGGAATTGATGTGGACAGGTTGCTGGAGCAACTTGCACAACCTCAAGTCAACGACGAC
TGTGATCCATACGACAGCGTTGGCGATAAAAGAACTGAGCATCCAGATCTGGCAGAGATCATGGAGCAGTTGATCAAATTGGTTGACGATGCGGTAAAAG
CGGGTTTCCCCGTAGCATATCGGCATCAATTGGAAGAATTAGTGAGGAAACACGATATTTGGCGCATCGATCTCCGGAATGACCCTCCTGCGAGAGTACC
GGCTTACGAGATTCGATTGAAGAAGGGTGCAAAGCCGTACAGATGTAAGCCAAGGAAATACTCACCAGCCCAAAGCAAGTTCATGAGAGAGTTCAACGAC
AAGCTTGTGAAGCTGGGTTGGGTATACCGGAACCAGGCCAGTCGATGGGCGTGTCCTGCGCTACCAGTGAGAAAGCCGGGAACGGAGGATTTTCGACAGA
CAAGCGACTACAAGCCTTTGAACGCTTTGACTGAGCCTATCGCCGGAGTCATGCCAAATCTCGATGCAAAGCTGCAACATGCCAGGCACAAGAAGCACTA
TGGACTTTTCGATTTCATTAAGAGATTTTGGCAACTACCGCTGGCTGAGTCGAGTCAAGAGATGCTATCCTACGCGACCGACGAGGGCGTCTTCACACCA
ACTCGAGTACCTCAGGGTAGTTGCGATGCGGCCTTGCATTTTCAGGCTACAATGGAGAAATGCTTTGCTGAGCTGGTCTACAAGTCTCTGCTGATCTGGA
TTGATGATCTGCTCCTGTTTGCAGACACCATCGAGGAATATCTGGCGGCACTGGAGACTTTGTTTGACACTATGGATCACTATGGGTTGAAGTTCAGTGT
AATGAAGACTTGTTTGTACCAGCAGTCAGTGACCTCGTGCGGCAAAGTAATTTCAGAGAACGGCATCACGCATGATCCCAGACGGATCAATGCTCTGTCG
AACATGCCTCCACCGTCCACGGCAGGTGAACTACAGCAATTTATCTGTGCATCTAATTGGATGCGCGATAGTTTGATCGACTACGCCCGAACTATACAGC
CACTACAGCAATGCTTGGATCGAGCGCTCGAGGGAAAACGAAAGACCAAGCGAGTCGCGGCTGGTATTGCGCTGCAGCTGAACGAGTCGGAGCTCGTGAG
TTTCGACTGTAAAGAAGCTGTTGGCGAACTCATCAACGCTAGCCCATCCGAAAGACAGCGCAGCCTTCGCATTAGTTTGTGATGCGTCGGATGTTGGATG
GTCGGCCATTTTGACTCAAGTGGAGAGCTGGGATGACGCAAAGCCTGTGACTGAGCAAAACCACGAGCTTTTGATCTGCAAAGGAGGGACTTTTACAGGC
GCGCAGCTACACTGGTCGGTCACGGAGAAAGAGTTGTTTCAGCGTGTGACGACTTGAACTACCTGTTGCTGCGGCCTGGGGGCTTTAAAATCTTTTGCGA
CTATCGCAATTTGATTTACATGTTTGCACCACACCCGGAAACGAAGAAGCATGTACGAGGGAAATTGCTTCGATGGTCACTCAAATTGACGGAGTATCGC
TACACTATCGCACATATAGAGGGTGAGCAGAACGTCTGGGCTGATTTAGTTTCTCGCTGGGGTGGTGCGCCGCCTACATCAGTGATGAGGTTCAAGCGAG
TGACGCGCATGCAGACGCAGGCAGAAAAACGACCATTGTTGAGACTTGACAAAGACTCGTTCGTCTGGCCAACACTAAACGAGATTGCCGCCACGCAAAA
AGCTCATCTACAAGACAGACCAGAGGCCTGCACGCAAGGCGACGATGGAGTGTACCGATCCGACGGCAAGATCTGGGTGCCGGAAGGAGCAAGTGGCTTC
ATCCAGAGACTGGTTATCGTGTCACACTGCGGTCCTCAAGGTCATCGAGGTGAGGCAGTGATGCTAAACCATATCAAGCGAATCTTTAAATTCAAGGAGA
TGGCGCAAAGGGCTCGGCGGTTCCTGAAGAGCTGTCTGCTCTGCGATCATGTAAAGGGTGGAGGAGTGATACCACGTCCATGGGGACCTTGTTTTCGCTC
GGACGTTCGCAATGGAGCTATCAACTGGGATTTTCTTTTTCTAGGGGAGAGTTTCGGAACAAGCAAGTACCTGCTGATTATCAAAGACAACTTCAGCCAT
TTTTGTGAGCTCATACCTTGCGATGCGCCGACCGGTCCAGCAGCTGCAGAGGCAATGATGTGGTGGCACAGTCGCTACGGAGTGCCCAAAACATGGGTCA
GTGACAACGCTACGCATTTCAAGAACCAGGTGTTGGCTCTACTTAGCAAGTTCATGAAGGCGAAGCAGGAGTTCGTCGTGGCATACAGCCCGTGGTTGAA
CGGCTCTGTAGAGCGCGTGAACCGCGATGTTTTGCAGGTGCTGCGAGCAATGATACTAGAGTACTCACTCTCATACCAAGACTAGGTTCATCTAATCCCG
CTCGTCCAAGCTAATCTCAATCACTCACCGGTGCCGTCGCTGGCAGGAAGAGCTCTTCACGGGGCTGCCATGCCCAAGTCCGATATCGACCATTTTCGTC
CCTGGTTATGCTCCTATCAGTGTGGACACCTCGAGGCAGACCATGGAGGAGTCTTTGGCAGCATTGAGGAGCAGCATTGAGAAGATGCATCAAGAGGTGA
CAGACCAACGTGAACGGCGGACGTTGTTGAACAAGAAACGTGCCGAAGGCTATCAGATGGTGAACTTTTCTATCGGAGACTATGTGCTGAGATCTCGCGT
AGATGAAAAGAACCAGAACAAACTCCTCGTGACGTGGGTCGGCCCTTACGTCGTAACGAAGTGCAACGCCCATTCGTTCACAGTCAAGCATCTCGTCACC
GGGAGGGAGAGCAACGTGCATGCCTCCCGGTTGAAGTTCTTCGCAGAGTGCGATCTGGAGGTGACTGAAGAGCTGCGTGAGCATATCGCAGCCCAAGGCA
TCGTGCTAAAGGTGGAGGCTATTCACCAGCACCGTTGGAATGAAGACATGCACGACTATCAGCTGGCCATCAGCTGGGAAGGTCTTGAGGCTATTGAGGA
CTCCTGGGAGCCTTTGAAGGTCATGCATCAAGACGTAAAGGTGTTAGTTGACGCCTACGTCGATAGAGCAAAGGATGAAAAGCTCACGACGTACTAC