Description :
From Genome Similarity Track
Location :
Scaffold_40:284027- 285203
Transcript NameFunction/comments
Phypa_INRA-310PPTG_14105calcium/calmodulin-dependent protein kinase

Sequence
1176 bases(100 bases per row)
GACGGGTGGATCACCATCGGTGCCAGCACGGGGGAGCGCTTCCCGTTCTCCTCAAACGACATGGAGTGCGCTCGGTGTCGGCCTGCCGCTGCGACGGCAG
CCATCACAACTGCCTGGTTGGATTTCTCTCTCGTATCTTCTTCATCCGACTCGCTCGAGCCATCTGATGACACTGCATCGTCAGCCTCCAAAAGACTATC
AATCGCGTCCGCAGTTACCAGCGATTCTCGTCTGTCGATATTACGCACGCTATTTAAATTACCACAGATAAATGAGCCCATTGCATACACAAGAGTTTCC
AATAAATGCTGCATAGTCCACCGTTACCTGATGTCCAGTTCGCTCTGAATGCTATTCATCATGAGCCGCTGGAGTAGCATGTCCATCTGCAGTTCCCATG
GCTTGTTGAAGATGGATCCTTCTCCGGATTTCTGGTGTGGGGAGCTCGTGCCAGTGATTGAGCCCTCGGCGTCTCCTTCTGAGCTCTCATTCTTCTTAAA
CGACGATCTGTGCGATGTCGTGGATATATCGGCGTCGTCGCAAGTCGTGGAGGCTCCACTGCTATTGTTTAACTCCCTCTCTGAGCGCTAAGATCAAAAA
ATTGACAAGGTTAAGGTCAGAATGGTCTTCCGCATACTCGCTTTCTCTTCTTGTACGCACAATTTGGATCTTAACCGCAGTGTGCGTGGCCAAGTTACCC
TTCTTGTGGATGAGTTTGAAGCAGCTAACGCAGTAGGCGTCGTGGCAGCAGCCATTGCAGCTCAGGCTCGCGCTGTGAAGCTCGCAGTAGACGCAGAGCG
GACGCGGGCCTTCAGTGATGGCACTGCCATCCTCAGCATCAGGCTCATCACTCGACTCATTACCAGCGGGCGCGTGTGTGCGCTGCATGTACCAGAGTCG
CCAACTGGCGTTCTCGAGGCGCACGGCCTCGTCCACAAAGCGGCGCATGGTGCTGAAGGACTGCCAAGACTTCTTGGCAGCCTTCTCGAAGACAGCCACA
TCGTCTATCATGGTGGAATCTCGGTCGGTCCCGAGGCTACGAGGTGTAGGGAAGATCGAGATCTGCTGAGCCAAGCAGCGTGCCAGGCATCCGATGGCTG
GGTGACGGGCTTCCTCCTACTGTAGCCCAGCGCTTCCTCGCAGACTCGTCTGGTTCAGTTCGTTATTTTTGCGTGC