Description :
From Genome Similarity Track
Location :
Scaffold_104:28400- 31282
Transcript NameFunction/comments
Phypa_INRA-310PPTG_19144DEAD/DEAH box RNA helicase
Phypa_INRA-310PPTG_19145myosin-like protein

Sequence
2882 bases(100 bases per row)
CACGTCATGGCGTCCAAGGATGGCTGGGATGCTCTTTTGCTGGATACCTGTAGGCGTCGTGATGTTCATCTCCTTCAGGCCCGCCACGACACGGACATCC
ACGCCTAAGTCCTGGAAGCTTTGCACTGCGAAGAAGCGGCGCGCCGTGGCTGAGGTCAGCAGCGCCGGTGGACGCATGGCCAGGCGGCCGCGCTGGAAGA
GCGACGCCGACGCGAGGCGCATCGCAATTTTGAGATGGAGCTTGTGGTGGTGGAGCCGGCCCAGGCTCCTGGGCGACCCGCGGGTTCAATACAAATTTTA
AGTAATTGGCCAGCGTATCATAATGCACAAAAAGTTGAAGTTGCCATGACTCACTCGTCTTACATGTATCGTAGGAACTTGACTTCATCACTAGATATCG
TGACGTTGCAGCAAGGAGTGCAGCGTTACATCGGTGTCACGTTGCCCCCCGACACTGCTTGGTGGCCAGCTTGAAGTGAATAATTGCCGTGACGACAGCT
CCAAGCGACGATCTTCTGTGGCTTTCGATGGACGTTGCGAGCTACAAGCACTCGACTAAATCTCGAGCGGACGCTGTGATGCAGTTCATCGACAGTGGTG
CTTGTTTTGTGCCATGATATCGCACTGGATTCCACAAAGCTCAGTGCCAGAATACTGCCACGAGCTCTGACAAGTGCTTGCGATCAAGTGGTGAAATTAG
CGTGACCAATCTGATCACTTTCTGTAAGCACTCTACATTTAGCGCAGTGCTGGAAGACACGCCCACATAAATTCTGCTGGTGCATTGTCTACATCTTGTC
TCGCTACTCGCACTTGCAGCCAAGAGCGAGTATTCTACTAATGCTGCACATTGAAACAACCAAGGCGCTGTTGATGAACTCGTTCGCCAACACTGGCAAC
ATCCCATCATCGAGTTGCCAAGCTAGGGAGAGGGCGAATTGCAGGCTACGCTGCTTGGACAGGCTCGCTGCAGTTCACAATGCGACGGCACTGTACGTCA
GACACAACAATTCGTCGCCGCCAACAACACGCTGTCGCTGCCGCTCGGAAGCGAAGCGGTCGCAACACCGCTAACCTCACTACCAGCAAGTTCGCTGCAC
GGTCAACGCTAGCACCTAAGATGCTTTTACATGGATATAAACTTACCGATGACATCGCTGATGGCTATAATATCGCCAAACAGCCAAGATCGCTTGTGAG
GGTCAAGTAGCCGGATGCATTCAGACTTTGAATTGCCTTGTTGTGGTCCACCTCCACAAACGGGTGGGTTTGTTTGCTTTACAAATTTCAAGTCAACATG
TTCTGACCCGTGAAACCCGGCCTCTCCCTCGGCTCGTCTCTCCTCTTTATCGCCTCGATACAATCGACAAGCTTCGACCGCGCAACCAGCTCCTCTGCGT
AGCTCGTTGTGCTCTCCCCCCGCTTCCTCTGTCCCCTAGCCGAGCATTTCCCCTCTCTACTCGACACCGTCGAGTCCCTAACAGGTCGCAGCAGCGATGT
ACTCGTCCTACTGGAAGCCCAACGATGGGCGCGAGTCCAACGTGCTGACAGACCACGAAGCTCTACACCGTGATGAGGCTACGCACAAGGCCATGCAGTC
CGACGAGACGGAGCTGCGTCCTCTGGATCTGGAGACCATCATGAGCTCCAAGGCCGCCGTCAAGTTCTGGTATCTCCACCGTCCCAAGACCATGGCGTAT
GTGCACAAGAACGCCACCAAGATCCAGAGTCTGGGCCGCGCATTCGCCGTGCGTAAGCTGCGCGAGAAGCACGGCGCCGAATACATGGCCGAACTGGCCA
GGCAGGATCAGGCTCGTCGTGACGCCGACGCGCTCAAGGACCTCTCGGACGAGGAGCGCGCGGCCAAGATGCTGGACGACGCCGCGTACGATGCACGTGT
TGAGGAATCCCGTCGCAAGCGCCGCGAGCAGATCGAGGCTGAGCGTCGCGCTGAGGAGGAGCTTCGCATGAAGCTAGCGGCTGAGGCTTCAGAGCGCCGG
CGCATTGAGGAGGAGCGCAAGACAGCGGCACTTGCAGCCAAGGAGGAGGCTGAGCGTCTCGCTGAAGAGGAACGTATTCGCAAGGAGAAGGAGGCCGAGG
AGGAGCGTCGTCGTCAGGCGGAAGAGGCTGCGCGTCTCGAGGAGCTCCGACTCATTGAGGAGGAGGAGCGTCGTGTGGCTGAAGAGGCCGAGGCCGCGCG
TAAGGCGGAAGAGGAGCGTCTTGCCGCGGAGGAGGCCGCTCGACTGGCTGAGCTGGAGGCGATCCGTGCTGAGGAGGAGCGTCTTGCTGCTGAGGAAGCA
GAACGTCTTGAGGCCGAGGAGGCAACGCGTCGTGAGGAAGAAGAGCGTCTCGCTGAGGAGCAGAGACTCCGTGAAGAGGAGGAGGAGCGTCTGCGTCTCG
AAGAAGAGGAGCGACTTGCTGAAGAGGAGCGTATTCGTAAAGAAGAGGAGGAAGTTGCTTTCTTGGCTGCTCAGGCTCGCGAGGAAGAGGAGCGTATCGC
TCGTGAGGAAGAGGAGGCGCGTATTCGTGAGGAAGAAGAGCGTCGTGCGCGCGAAGAGGCTGAGGAGCGTGAACGCAAGCTGGCGGAGGCAGCGCTCGCT
GCTAAGCGCGCGGAGGAGGAGGCCGAGCGCATTCGTCTGGAGCGAATCCAGCAGGAGAAGAACGAGAAGTACGAGCAGTCTCTGTCCAAGGACGTGCCCG
TGCTCGTTCGTCAACGTGGCCCTGGCCGTGTCGTCAGCTACGACAAGCAGCGTGAGACTTACGCCGTCAAGCTCGAGAACTCCATGGGCGGCATGCAGAT
CACTGTTCCTAGTGACGACGTCAACCTGGATGACGACCGTATCCTGTCCCCACGCACCAAGGTGGACACGCCGTTCGGCACG