Description :
From Genome Similarity Track
Location :
Scaffold_181:284- 1972
Transcript NameFunction/comments
Phyta_totarag5167hypothetical protein PHYSODRAFT_477864

Sequence
1688 bases(100 bases per row)
GATATCTACGCAAGACAAGACGACAAGGCACAGAAAACACGAATACGAGCTACCATTTGGCCCTAGACGATCCCAACTCTTAGCTATGTCTGCACATTGC
CGTCTCTAATGTGACTGACAGACGGCGTCTATCATCGGTGCAAGTGAGCAGGGATAAATCTTGTGACGCACGTAACGGCCTACAGGAAGTGCGTCTTGCG
AAGATCCTGGTACTTCTTGTATCCGGCAGCCACAATGCCGGCAAGGATGAACAAAATGATGAAAAACGGCGTCTTCCAGCTACTGGACTTGGCGGCCGTT
TCCTTTACAGTCTCTTCCAACTGCGTATCCACTTGGTCGCGGATCGCGTTAACTGTGCTGTGCACACGCTCGACCACCTTTCCGTTTGCCCAAGCCTCAA
GCTCAGCAATCCGCTTCTCGTCCTCAGCACCCTGTTCCTTTAGCTTCTGGATCGTGTTCTCCGTGGACTCCTTTAGCGCGGTGAACTGGTACTCAAAATC
CTCGAGCAACTGAGTGTACTTCCGCTTGACCAGTTTcatcttgtcgtcgttgttgcccTTGCTCAACGTGGCTTCGAGGTCCTTGTCCACAGcattgcgc
tgcttctcatCTTCCTGGGCAACGAGCGAGTCAATCACGTCACTGATAGCAGGAACAACAAGTGGTCAGTCTCATTAGTTCCAGTAAACATAGATATCTC
CATGCAAAACGAGACGGTAGACAGGACTTACTCGTAAACGTTAAAAGCAATGACGTCGTGGTTGTCAGCCAAACCACCAGTCGAAGCCGAGATGCCTACG
TACGCGTCGTTCATCCAGTCGTCGCCAATGTTAAGACGCTGGCTGTAGCATTTGACCCAGTTGCCCGAGGCATCAGCGTCGATCAGGATCGTAAACTGCT
GATTCACCTGCGTGTACGTGAGCTTAGCACGGGACATGTTGAGTGACGGGCTGAAGgctgcgttcttctcgtGGTAGCGAATACCGGGGGCCATGCAGCC
CATCTTGTCCATGTCGTTGAGCtggtccagcgtcttcgtgcCGTCGTTTTCGAAGAACGTCACGTCCTTGTGGCCGCCGCTGTGCTCCTGGTTGATGAAG
GTATCGAACACGACACCGATACCCTTGAAGTCTCCAATGAAGCCGTGGTTATCGCCCTGCACATACTGGCTGGTAGTGAGCCAAAGCGCCAGGCCGTCGC
CGAACCAGGCTTTGGCTTGGCCGCTGATGCGGAACGTGAACACGGCGGCGAACTCCTTGGCCGACAGCTTTTGTTTGCCCCAGATGTGACCGCGCTTGCT
CTGACGGTCAGGCGTCAGACGTGCGAAGTGGCGGTTCACGGCCGTGTCTCCGCCGTACACGAAGTTGTCTCCGATCTGGCGCAGACCTTCGCCGTTGATA
TTGTCGAAGGGTTTCTCGAAGGAGACGTGGTCCATGAGCTTGGCGCTTGTGGGAGAAGACTGCAGCGCGGCGAGAAGCGTCgccacgcacagcagcagac
cgaAGCTCACACGAGAGACGCTCATGGTCGGTCGATACACGCGGAAGTAAGGCTAGTGTCTACGTCTAAGCCTGGTTCGTCAGACTACGATTTGCTacgt
ggcggtggcaccTGGTCGGGACGTACTGAGGATGAAGACTTAAGTACGATTATTGCAATTAATTAGAAGCGTCACTTCAACCTGCCTT