Description :
From Genome Similarity Track
Location :
Scaffold_3469:284- 1691
Transcript NameFunction/comments
Phyta_totarag15307hypothetical protein PHYSODRAFT_262200

Sequence
1407 bases(100 bases per row)
GTANTCTCTGTAGACCGTTTCAGCAAGATGGTACATCTAGCTGCAGTGCCGGCTGAAGTGACAGCCGTGCAGACAGCACGCTTGTCCGTAGACATGGTGT
TCAAACACCATGGCATTCCGCACGACATCGTGTCGGGCCGTGATCCGCGCTTTAGAGCACGGTTCTAGCAAGAAGTGTTCTCACTTCTTGGAACACAGCT
GTCGATGTCAACTGCGGATAATCCGCAGACGGACGGGCAGATCGAGCGCTTGAATCGCGTGCTCGGCGACCTGCTCAAGAGCTACGCGCACTTATTTCAT
CACTGGAGTGACTGCTTGCCGATGGCGAAGGTCGCCACCAACAACTCGGTGCATGCCTCGACTGGGTATACACCGTTCTACGTGAACGCCATGCAGCATC
CACGCCTGCCGAGCATGCTCGGGGCGGCGACTTCCTCCTTAAGTGGAAGTGAATCTACGAATGCGAACCAGCAACCGCAGATAACAACTGATACGGCCAC
AGTATCAGTTTCGACAACGAACAAGAACACCGTGGCTGTGCCGGGCACAGCCACCACAAAGGATCACGCACAGACCGAGCCTGCAGTGAAGGGCAAAAAC
AGCGCTCACGGACACACACAGGTCGAGCCTGCAGCGGAAGGCGCAGTCGATCTGAAACAAGTCATTCAGCTCGGAACCAATGGACGTTGTCCAGCGTAGA
CAAGTCCTTATTTGATTTGTCCAAGCTGCTACTGTAGCTTCTGCAGATCGGCAGAATCTGAACGCTGACAATGTCGGCCGGGGCAACAAAAATGAATTCA
AAACGGGTTCATTGGTCATACTAGCTACCCAAAACCTAGTTGAACATGCAGTCTCTGACTTCGGAGCAAGCTTGCTTGCTCCGTGCTTCATTGGGGCCTT
CCCACTGCTCGAGCGGCATGGCAACGCTTACACGCTGGACATCCTACGTCGGGCGGCTGAAGCCGTACGTTCAACATGAGTCACCTAGTGCTGGTGATCc
gccaaagaagaagaagaagcaggggCAACCTGCTTctcaagctccagcttcagaGCGGCGAACTCAGCGCTCTGAAGCGTCTCCACGGCCGCCACTGGGT
CGAGGAGACGGGAATCACCCTGGTCAACCGAAGGTTGACCATACGAAGCGCGTGTTCCAGCCTCCCCTGTCGCCACTGCGTGACGCACGAGGCTCGTCCT
GCTGGGGTGTGGAGCGGATCGTTGGTCATACCAACCCGAAGTCAAGTCAGGCTCGTCTTCGTATTCGATGGAGAGGATTTGATCCCCACCAAGATACATG
GAAACTTCGGGACGTTTTGATGAATGAAGTTTCGGAAACCGTAAGGACTACCACGGACTGCAGGTATAAAGCTTGCACGAGCGTTGTAGTTGCCAACAAC
GTTCGGA