Description :
From Genome Similarity Track
Location :
Scaffold_109:284- 1547
Sequence
1263 bases(100 bases per row)
TGCGAGCTTCCTCAACACTATAGTGTAAGCAAGTAACGGAGTAATACTTGGCCCGTTACACCTGGTAGCACTTTGTAGTCCTTCCAACGACCAAGTTCGA
CATTAGCCAAGACCTCGACCACGCTGCCTTTCTCCATCTCACTCGGATCGAGTGGGAAGCTCTCCACCGCCTCGCGGCGGTGTCCGGAGAAGCCGTCGTC
ACGTCGCTGCTGCGCTCAGCGACGCCCGACGAGCAGCGCGTTGCGGCACAAGAATTCATGGAACGCGAGCTCGCCGATGCGAATCGGCGAGTGTCAACTC
CCTCGCGTATCTCCACGAATGACGTCGTGAAGCTAGAGACGTCCACCTACTCCGGTGCCGGAGAAGATCGACTTCCGCTGAATCGCTGCTTTCGAGAAAT
CGACATCGCCATCGCCTCGAGGTTGATCGAGGCGCCTTCCGCGAAGGTCCATTTCCTCCTCTCGCGGCTGTCTGGGAAAGCCAAGGAATGGGCTCTCGGC
AAGTTGGTTGTCGATCCCAACGTCTTCCCCACTCTGGATACCCTCCAGAGTGACCTTCGGCTCGCGTTCGAGCCGCCGCAAGATGAATCCCGAATTCGGG
CAGACTTCTTCGCCCTTCGGCAAGGCACGATGACTATGCGCGACTACGTCCAGAAGACACGACACCTCGCGTCGTGCATCGTGTCTAAGCCGATCGATAT
GGCCTCTCAGGTTCATGTATTCGTGTTCGGTATGCGCGAAGGCATGACGCGCTACTCCCTTACAAGATCGGACCCCTCTACGCTCGAAGAAGCATTCGCC
CTCGCCCTACGCGAGGACTACGTGGTTGCGGCGTCATACGCTCACGCGCTACCTGCTTCTGCTCGGGATTCTGCGCCCGAGCCCATGGACATCGACGCTA
TCGATGCAACGAGCAATCGTCATCGTCATGCACCGCGTCGGAGCGGTGCTCGCAACAATCGTTCTCTCACCTGCTTCCACTGTCGGAAGGTCGGTCATCG
CGCGGCGGAGTGCCGCGCGCCAGCTCCAGTGCTTGCGCATGTCGATGCCGAGCCCGTGAGCTCTGACCAGCCAAAAACGGTCAGGGTCAGTAGGTGCGGG
GCGCCCTACTGGCTGGAATGAAGGTCCGGGTCCCCCGGTGGCAACCCAACCTCCTAGCCCTCCTGTGCTCCATGCACATTTTCATGCCACCACCACGCCG
AGCGATTCAAGATTGATCATTGTCAGTCTTCATGTCGCCGGTGCCCGGCGACCACTGCGAGCG