Description :
From Genome Similarity Track
Location :
Scaffold_3614:284- 1374
Sequence
1090 bases(100 bases per row)
TCACCCACTTGAACTCCTCGGAAGTTACCGAGAGAGCAAGATCCCGCCCTACCGACGGGTACACAAGGTGAGGAAAGTTCAGCAGAACACGGATCATCGG
GGGACCCCCTCCGTTAGTCGGTGTCTGGGTGCAGTTGGTAAGCTGGATCCGGCAATCTCGCAGATTTTGCTGATCCCGCTACACCACAATGGGGCGCGTG
CCCGGATCTTTTGGTGACTCGGGATTTCACCGTGAGTCCCAAGAAGATGCTCAAGTGAAGATTGAGCCAGGGGAAGAGGCGTCGTCGGAGGTCGAATCGA
CGAAGACGCTGCTGAATGAAACAAGATCCGCGGATCGATGGAGTTTTGGGAGGAACTCTGTCGACGGAAGAGAGGTGGATCCGGATCCGGATCTAGAAGA
AAAACCTCTCTATCCTCCCCAGGTCCCCTCGGGGACCCCTGCGGATCTTGCCGCAAGTCAATATCCGCTAACAAAACAAGGGAAAGTGAAGGCGAAACGG
TATGCATTTGCAGATTCACCGGTTAAGCCAACACCGTACCTAAACCCAAGCCCGCTAGTCGAAGAAACGAGAAAGAAGACGAAAACGAGTAAGACTACGC
GGAAGAAGATGCAAGCTCCAGAGTCGGAAGAAGACCAAGCTGGATCCAGGTCAAGCTGGTCCGACAAGGATCTCGAGTTTGTGTATCGCCACCAAGCTTT
ACGCGACTTTCTGCATCAAGATCCTGTCATGCGGATCTTGAATCCACGACAGATCGAAGATCCAAGGGAACCGGTGAGAGCACCAACGAAAACGGCGAAC
AAGTTGGTGGCAGTCAAAGATCTATTACGTTTGCTTACGGAGTCAGGCATCGTAGCTGGCGTGTTTGACGCAGAGGGCATCTTCGAGCTAGACCTGGATC
TCATAGTATCCGCGACGCGGGACCTCTTTGCCAGAGTTAAGTCCATCACCGGAGAGAGGTCGCGCACTATGGATCCAGTGTCGTCGCCGAGGATCAGCCA
AGCTGCGTCCTCGAACTACGAATCCGCGGCGGAAGATGGCTCCGACACGTCGTCCGTGTTGTCAAGAAGGCGTCTCGTCCAGCTTCGGCA