Description :
From Genome Similarity Track
Location :
Scaffold_12:283941- 288648
Transcript NameFunction/comments
Hyaar_Emoy2802306conserved unknown protein

Sequence
4707 bases(100 bases per row)
CATCGTCTAACCATTGTCCTAAATGATGTACCAGTCTTGTTTTGGTTCAGCCATTCAAAGTTTAGATCAGCTGAATAGGAGACAAGCACCTCAGCAGGGA
ACGTTCAATTGACCTTTTGCAGCACCCCATACCTCAGGATAAAAGATGTTTACCACACAACGAGTGGTTCTGTAAGGCTCTTATCATACAGGCACCCTAA
GATCCCAATTTCGACAGCAAATTCGAGTACGGGAACCTGGCGTCTGAGAGATGGTCGGGCATCGCCGAGTACTTGAGCGGATATGCTGCAGCTGGTGTGG
ACGAAAGCGGAACGCTGTCACTTTTGCTGGTTTGACGACGTAGTTGCATGTGAAGGTGCTGGAACTGTTGACGCGCCCGAAAAGCGTTGGCTTCCATCTG
CTGCATCGCGTACAACTCCTGGACTTGCAAGGCGTAGGTAGCGTGCAACTGCTGTAATTTCATCGTGAGCTGCTTCTTGTGGCGCCGCTTCAACTGCTTC
CGCTTGTGGAAGTCGTGCGCCACCTTCCGACGCCAGTTCATGCCACTGGTTGAGACCGACGAGGATTTCTTCGAGTGATGGTGCGATGCACAGCTGCAGT
CCGGAAGGTTGTAGATACGCTCACGTTCGGCGAGAAAATTCATTCGGAGCCGCTCGTTCTGGCGCGAAAACTGCATCAGCAAGCTGGTCTGCTCGGTTGC
AGCCACTGCACGGTCAGTCTCCACATCGATATCGGCAACAGCCGATGTCTTGCTGTCGCTACAACTCCTGGACGCGGTATCAGCGTATTGATACATGGTA
GCAGCTAGCAGTGAGCCCTTGTCACTCACGAGTGGTACTGACATAAACTCAGGCTCGTACTGTTCTAGTCGCTCGAGTTCCTCTTCTAGTTTGACGTCCT
TCTCCCTGCCAGACGGCGTCACCTCGTTGTCTGCTTCAATCGGCTCCTTTCGCTCGCTCGTTGTAGCATCCCGCTTTTCTACTTGCGAGCGCGCAGACTT
GCTCGACCCTATGAAAGCTTGCTTGTTGGAGACTACAGCTCCCGCAAGCTTCTTTGACGACAGAGACTCCTTCCCTGCGTCCTTCATTTCTGTCCGAGCC
ACCTCACCATTCTCTTCAAAAACACCACCTTCAGTACGCTCATCATCCATGAACAAAGCTTGCGCTCGCACTCGACGCATAGCCTTTCTTTCACTGATTG
CATTCATCGCCACTTGTGTACTGCTCGAGCTCAGCGGAGCCGCGGCTATGGTTCTATCGACAGTAGATTCTTCTACTAAACGCAAGTTGTCCTGTCGTGA
CTTTGCTGTCGCCGTGCAAGGCAAAGTCTCCGCTTGTCTCGTCAAACCTAGCAGTTTTTTCTCCAGTCTTGACAGCCCAGGCTGCTCCGGGGTGTTAGGG
TGTGAAGAATCCGACGACGACGAAATCGATACAACTGGAGATGCTGCGCTTGTCCATAACTCGTCACCATCACGGTGCGTACTGTATCTGGGAGTGGCCA
CCAGTGTCGTGCGCTTGCCGACCTGGCCTCGAAAACCGGTCAGAACAAGCTGCTTATTGTCAACGGCCTCTTGTGACCTACTATCGGTCAACAGCGGTGC
TTTTCTTGTTGCTCGTGACTTCACAGCGGTTTCCTCCCGAGAATTGAACTTCTCGCCGTCGTGCCGGTTCCGCTTTGGTTTGCGCTCCACTACTTGATTT
TGCCCTGCTTCTTGACGTTTCAACATGAAATCCTGGCGACTGCGCTTCAAGGCCATGTTCAGCTTTTTCTGACTCTGGTGCTTCTCCTTCGCGGCATTCT
CAGTGCTGACGTCTGAGTCGCTGCTACTGCTGCTGTCCGAGAAGCTATCTGCTCCACCGAGGTCTCGAATCAATTCTCCCAAATCTCTCTTTACTTCGAA
ACACTCTTTATTACGCTCGTTGCGGTGTAAGAAGGCATCCAAGGTCTGTACGAGAAGCTGGTTTTGATTGGCGGCTACAACCATCCATTTTTGTTTCTCC
ATTTCGGGAAAAGGGAGGACCGCAAGAAGACCACTCGTGTTAACTCGAGTGAGATCCGAGAATTGTGCTTGAAAGTCTAAGGATGGGTCGACAAAAAACT
GCTCATACCCTTCAACGTAGTTCAGCGGTGTCGCAAGCCCTGTTTCCTTTGACGGCTGGTGGATAAACACACTACCATCGCTGCACATACCAACAGTAAA
TGGCGAAGCATCTTGCCCGGCAATTTTACTAACAGTCCGCATGTGACGCTGTCCACTCGTATCCTCAGCACCGCGTCGACGGCTTCCACGGGGATTCCAC
GCACGTAACGAATTAGCATTTCTCAGATTGACTGGGGCTTCGCGCTGGGCACGTTGCTCCTTTCGTGATAGCGGCAGGTCCAAGTCCATACGGACCGCAG
CTTGGAGATCAATGACGGCAAGGGATTCGCTTCCGCCGTAGGCATAATCACCGTACACCGCCACCGAGTCAAGTGTCTGCTTCACGTCAGTATGTGATTG
TTTTTGGATTGTCACCGAGTCGACAACAGCGTCGTAGTCTTCTTTGAGATGCCAGATACGCACATTTTGGTGCTCAGACTTGGAGATAAACTGGTTCGCA
CTCGTCGGGTGAAACGAGATAAACTCCAGTGAAATGCCATTCGTCTGTTTGTCAAACACGCACTCCCAGCTCCATTTCAACTTTGCACCACCCATGTTCT
TTTTCTGGTAAAACCGCCACATGTGCACGTTTTTGATGCCAATCCCACACAGCAAACGGTATTCCGTCTTCCCGCTCGTCTCGTGATACAAGCTCTTGGC
AGCAGCAAACCCTTTCAGCTTTGCATCTGAAAAAGTGTGTGCCACGATGTGAGCAGTCGGTGATCGAAAAACATCCGTCAAAAAGTCTCCATCACGGTCA
CTCTCGTCACTGTCGTCAGCACTCAGCAGCGTCATCGACGTATTCTTGGCATGGCTGGTCCTAACAGTGCCTCTTTCCTGAAACAAATCTTCCGTCCGTG
ACGGGAGCTCGATACTGTCCACTTCAATTGCTCGAATGTCCGTCGAGCCACGATAAACTCCAGCAAAGATGAACCGCCCGTCTGTCGGGATCGAGACCGT
CACCATGATCTGAGTATACATTCCTCGAGGTAAAATCTGATCCAAGAGCACGCCACATTGGAACGAGAGCGACTCTGCTGTAAGTGGGTACAGATATACC
ATGCCATTGTAAAAGCCAGCGACGAGAAAAGAACCGTCGGGCGCGATAGCGACCGATGAGACGGTTGACGACACAGAAAAGTGGTACTCTTGTGCCTTGA
GAGATACTGGACAGCAACTATGGATAGTATTGGACGCTTGACTTGGTATAGTTGATGCAACTACTGGTGCTAGAGCCGGATCTTGAGTTGCTGGAGCCTG
AGATTGAGGTGCTGGTACCGTGCTATTGGTAATCAAGCTCGGGGTTGTTGTAGTAGATGTAGTGACTATAGTGTCACTAGGACGGGTGAGAGTAGGACGA
CTCGTGTACCCGACTGGTCTCGTCTCTTGTCCGAGTGTCTTGATTGGTGTACAGAACGCCAATTTCCGTTTCGTCGTCACGTCGTGACGACAGCTGTCTC
GTCTGGTTGTGTTGGAAATATCTTCAAGCACGCGCGTGGATTTTCTTGGGACCCCTACCCGCGTTGTATGGTGAGTGGTTGAAAAGGCCGGTTGGTGGTG
CAACTTTGTTGAAAAGTCTACTTGCACTTGCGGCAACTTAAACTTGGTGGTCTTGAGTGTCGGTTGGTCACAAAGTGTGAGGGCGTCTTGGGGCTTGCAG
CCATTTGTAGGCGCCGGTGACACGAACGATGGCGACGTAAAGTGACGATCGGATGAAACTTGCTGCTGTATTGTCATCGTTCCGTCGGTATTGGCAGGCG
TCGCGAGCGCAGATGGTCGTTTACTATGGCACGACGGAGTGGACGTGCTCATTAGCGGTGGAGGGGAATGGAGTAGGGGAGGGAGATTTGACATTATGTG
TCGAAAAGGATTTCGCATATGTTGCAAGTGCGCAACGTAAGACATGGCTGAGGGTGACCATGATTTAGATTTTACGTAGTATCTATCGTTATGGATGTTT
TGCATTTGTCGGATTATTTCTTTCTGTTTTATAATGATTCCGCGTACTTTTGTGCGAGCACAACAATAAGCAAGGCTGAGCGTGAACATGATTTGAATTT
TGTGTTATATCCATTTACGTAGATGTTTTAAATCGAGATATTTGTCGGATCAATCTTTTCGATTTTTTGTTTTCCTGAATAGCAATATGGTACCGTCGTC
AACGTGGTAAATTAATTTGTTGACGACCATTCTTTTTTATTACGTTAAAGCGCTTACTGAGTAAGGTAGGACGAGATTTATACTAAGTACATCGCCAGCT
ATAAGCTCAGCAGCACACATTCGCTTGAACCCATATCATGACCCAAAGAAGACGAACACATGATGTTGCGAGATGCACAGAACAATATGAAAGACGATTG
CTCCACACTTTTTCATTTTTCTCCACAAGTGTAGCATTGTAAATCTTAGCTACTTTGTCAGGTGGCATCAGAACAACACAGTCATTTTCGACATAAACCA
TTGTAGTATGCATCTTCAAGACACTCACTCAGAAAGAAAGCTTTTTAACCTACGATGAAAGGAAAGCAAGCATCATTAGTAAGCGTGAGCTTGCTATCAA
GAGCATA