Description :
From Genome Similarity Track
Location :
Scaffold_38:283933- 285577
Transcript NameFunction/comments
g11084.t1XP_009515677.1 hypothetical protein PHYSODRAFT_473081 [Phytophthora sojae

Sequence
1644 bases(100 bases per row)
AGAGCCCACGAACGGGTGAGACCATCGTCCATGGTCGCTGTCGTGAGCTTCGCCAGTGCGTCAGCTTGGTTAATGACAGCCTGGTTCACAAGCAGCAGGG
ACAACCAGGCGTTGGTGGTGTCGTCACCCGTCACAATCGCCTCCTTCGACAGGATATCGTCCCATTCCTCCTGGATGAACGTCGCCGTACGCACCAGACC
ATTGATCGGTGACACAGGGATCATCTGAATACCGTGGATGCAGTACTTTTCGGCACTGAACCACGTCGCGTAGTCCGCCTTGTTGTCGAAGAAGATGCCC
GTGACGTGGTTGGGCACGAACTGAGGCGGGTGAATCGTGTTGTCCGACGTCATGAGGAAGTAGGTGCGCACTGCACGCGCGTTGAGGCGCAGCATGAGGC
TGCCCAGGTCCTCCACCGCCTGGTTCTCCGTCACCTTGCCCCACAGCATCATACCGTAGTAGAAGTTCACATCCTCCGACGTGCTCTCTTCATCCTTACC
ATCAGCCATGGGGGTCACACCGTGCGAGTAGGAGTGACCCAGAAACCAAGAGAAGTGGCGGAACTTGGGGAAGTGTGTGTCCTCCGAGCTCGGGTTGGCC
ACATCGCGGAGCAGCGTCCACACCATCGTCTCGAGTTGAGCCATGCCTGACCATGTCGGATCCAGCTTTTTCAGGATGGCCGACGCTGTGATCCAGTAGC
CGTAGTGGTAGTGGTGGTCGTTGTACACTCCATTGCCAAACTCCACATCTGCGTTGTTGGCGGTGAAAACCTGGCTTGTCACAATGCCCTTGTAAGCGGT
CTCGTATGCAAGGGGGGAGCCAAGCGTGTTGGTCAGGAACGGTTCAACAAGGGTCTCCAGCTTTGACAGACAACTGCTCAGTAGCGTGGTGTCATCTCCC
ACCACTGAGCTGTCGGCGGCCATCAAACACAATGACGCGTATTTCTGGTACGCCTTGCCGTTGAAGTACCAGCTGCCAGTGTCCAAGCTCCAGTCACTGT
CAATGTCGCTCTGCAGCGTGGCGAGAAGACCAATCTGCGAGACCACGTCGGCAGACGGCTTGTTGGCTGGGTAGAAGTCCACCTCGTCGTCCGCTTCATC
CTCCGTCAGCGTCCAGCTACCGGACGTGGTTACCTGACCTACCATTTGGCCACGCGTGGCCGAGTGCAGGACAATCGCTCCACTCGACTGCGTCGTAGTG
GCATCACCCATGGCCTCCAACTGGTGTGGCAGCGCGAAGTGCAGAAGACCTGTGTTGTCGCACCCACTGCCTTCCGTCTCCCACTGCAGCGAGTAACTCG
TGCGAGACTCCACAGACACGTTGCCGCCACGGATGATGCAGGATGAATAGTCGTCATACGCGCTCTGATCGCCGCTGTCAGGAAGGATCGCCACACGAAG
CGTGCCTGTGTAGGCTGCGCTGGAAACCAGCGCCGACCCGGTACTATCGATGGAGAAGGACGCGCTGGAGTCGCTGGAGTAAACCACCCACGTCTGGTTG
TTCGGCAGTTGGATGATATACTTGCCTGCGGTCGAGTCATCTACCATTGTCATGGCGTATTCGGACTCGATGCTTGCGGTGAGGCCAGAGTACGTGGCCG
AAACGAAAGCCATGCCGTTTACGAGAGACGAGTCCATGCAGCTC