Description :
From Genome Similarity Track
Location :
Scaffold_961:2839- 4036
Transcript NameFunction/comments
Pytiw_DAOMBR242034fgenesh-piw_contig_961-abinit-gene-0.30Mitogen-activated protein kinase

Sequence
1197 bases(100 bases per row)
CTGCGGCCGCCGCCTATGCACTCGTTCACTGCGAATGGCCAAGTGTTCACGCTCGACACGCGCTACAAGTTCTTAAAGCCCATCGGCACGGGCGCATACG
GTGCCGTGATCTCGGTCAGAGACGCCATGGCGGACACAAGCGTGGCCGTGAAGAAGATCACCAACATCTTTGAGGACCTCATGGACGCGAAGCGGATCTT
GCGCGAGGTGCGGCTGCTGGGCCACTTCCAGCACAAGAACATCACGCGGCTGCTGGACCTGTCGCCTCCACTTTCCAAGGCGCAGTTTGAAGACATGTAC
ATCATCACGGAGCTCATGGAGACGGACCTGCACCAGGTGATCTACTCGATGCAGTCCATGTCGGACGACCACGTCAAGTACTTTCTGTACCAGATGCTCT
GCGCGCTGCACCACATCCACTCGGCCGGCGTGATCCACCGTGACATGAAGCCGAGCAACGTGCTGCTCAACTCGAACTGCGACCTCAAGATCTGCGACTT
TGGGCTCGCGCGAGGCGGCGTGGCGACCAACAAGCAGCAGCAGCCGAACAGTCTCAACAACAGGGGCCGCAGCAACCGCGAAGAGCTCACCGAGTACGTG
GTCACAAGGTGGTACCGCGCGCCCGAGATCATGCTCAACTGCCTGCAGTACACGGAGGCGATCGACGTCTGGGCCGTGGGCTGTATCTTTGTCGAGATGC
TCCTGCGCGAGCCGCTTTTCCCAGGCAACGACTACATTCACCAACTTAAGCTCATCATCAAGTTCCTGGGCACGCCCAAGCAAGAGGACATTGAGTTTGT
CAAGAACGTCAAGGCGCTGCGCTTTCTCACCAAGCTCGCGATCTTCAAGCCCAGGAAGTGGCACGATGTCTTTGCCGCCGAGGACGACGTCAACCCGCTC
GCGGTCGACTTGCTCAGCAAGATGCTCATGTTCAACCCGGAGAAGCGCATATCGGTCGACCAGGCACTGCAGCACCCGTACCTCGCGACGTTCTACGATC
CGGCGGACATCACGAGCGCGCCCGAGTTTGACTTTTCCTTTGACCTGCCGGACGACAAGCTCAGCAAGGAGGCGCTCATCGACCTGCTCTGCGAAGACGT
TGCGCACTTCCACCCGGTAGTTCCGCCAGCGACAGCGACGGCTTCAGGTCCCAGCAGGTTCTTTGGCATGGGCATGACGGCGTCAGCAAGCTGAACT