Description :
From Genome Similarity Track
Location :
Scaffold_1:2838765- 2846861
Transcript NameFunction/comments
Physo_464526gag protein

Sequence
8096 bases(100 bases per row)
CCTGCTTCCTCTGTTAAGAAGTGCTGTGTGCCCCGTCACACTTGGTAGCACTTGTAGTCAATCCTACGCCTACGCGGGTAGATTGGACTACCTGAATCCT
CTGTGGTCTCATCGAGTGAGCCAAGATGGATCGTACGGAGTTTCCCCATCTGAACGACTCGCAGTACGAGTCCGTTCGTAAGATGGCAGGCAACTTTGGG
ACAGATGCCCTGCGTAGCTTAGCGGCGGCGACGCCGGCTGAGCAGGTTGAGCGTACCGCGTTCGACACCTACGAGCGAGGGCTCATCGCCCACGTTCAAG
GGCTGCAGGTCACTGCAGCCGCGCCGAAGCCGGTGCAACCGAAGCCCCTGCGGCTAAAGGTTCACCCCTTCGAAGGGAAGGAAGGAGAAAACATTCACTT
CTGGGTTCGAGAGGTTGAGCTCGCGATGGACGCGGCTCTCGTCTCGGACGAGCGACTCCGTGTCGCCTTTGCGCTCTCCAACCTTAGTGATCGCGCTAAG
AGTTGGGCGTATACGCGCGAAGCGACGACGCCTGGATGCTTCGCATCATGGTCCCAGCTGTGCGAGCAGCTGCGGGCCGCGTTTCTTCCGGCGAACTACG
AGTACCGCCAGCGTTCGCGCTTCCTCGCCTGCAAACAAGGAAGGCGCGAGCTGCATGAGTACATCCAGGAGATGCGAGTGCTCACTGCCTCTTTGGTGGG
GAACCCCCTGCCTGAATACATCAAGGTGACCGTGTTCATGGACGGTCTGCGTGTCGGTCCTGCCCGCACGCAACGGTTCCGTGTGCAAGCAAACACTATG
GAGGAGGCGATTCAGATCGCCCTCCAGGAGGAGTACAGCCACAAGCAGGCTCGTACCCCCGCCACGGTATGGCAGAGCAACCCTGCCTCTGGCGGTGCGC
CTAATGGTAACTCCGGCAATGGAGCGATCAACGGACCGGTTCCCATGGATCTGGGCATGGCCGAGCAGAGCGACATTCGCTGCTACGGCTTTGGCAAGCT
TGGGCACATGAAACGTGCTTGTCCCGCGGGAGGACTGAAGAAGAAGTTCTCTTCGAAGCCCTTTGGCTCTAGGGGTCGCTGGCAGAAGCGGCGCCCCAGG
AACCAGGGGAACGCCGGACACCAGTAGGGGCGGGGCGCCCTACTGGGGAAACACTAAGTCTTCATGAGGGGCGTGCGGGTGGCGCACGCCATGGGGACTT
AGCCCCTGAGAGTCTCTGTACTCTCGAAGCGGAGAAGGCCAGGTGGGCTGCTTGTGGTGCACGCGAGTGTACCGGGATACAATCATCCCTTGAGAATCTT
GATCGACTCTGGGGCGTCTAAGAACTGTGCGCGCCGCCAGACTGTCGCACGCAATCGCGACAAGTACGCCGATGCGCTACGAGGCAGCAAAGGCAACGGG
CTGGTCTCGGTAAGACTGGCCGACGGTACGGTGGTAGAAGTACCTCGGGTCCACATGAACCTCACTGTCAAGTTCGAGGACTTCGACAGCACGGAGCCGT
TCTTGGTCCTAGACATGGACAAGTACGACTTGATCCTTGGCATGCCGTGGCTGGAGAAACACGAGCCTTGGATCGACTGGCGCGGCAAGGCCATCGGGGC
CAGCCGTCCCCCACGCTCTGACAGAGCTTTGGTGAGTCATGTTCCCACCTCTGGCAGCAGCTGGGGCGCCCGCGAGGGCCGCCAGGGCGCAGCAGCGTCT
AATGAGTTCTTGGGGTCCGTCGAGACTGACGACGACTCCGACCGGGCCGGACAAGGCCTGAGAGTGGAGGTGCCGGACAGCACCTACCAGGTGGGTAACG
TAGGTCCACACACGGGTAACGAAGTACCGCAGGCAGCAAGGGCTGCTGGAGAAGGCGCCGCTGGCGTTGGCGTGGGTAACCAAGCTCCACGCGAGGTCAC
TCAGACCGTAACTGATGAGGAAGGCACTGCAGGCGCTTCCGATGTGGGTAACATAGTTCCACAGGAGGTCACTCAGACCATAACTGATGCGGGAGTCGCT
GGAAGCGCTCCTGGTGTGGGTAACCAAGTTCCACACGGCGAGGTGGGTAACATAGTTCCACCCAGCAAGGCGGGTAACCAAGTTCCGCTCAAGAACAAGG
CGGGTAACCAAGTTCCGCTCAAGAACAAGGCGGGTAACCAAGTTCCGCTCAAGAACAAGGCGGGTAACCAAGTTCCGCTCAAGGACAAGGCGGGTAACGT
AGTTTCGCACGAGATCGAGAAGATCGGTGGTGCCGTCAAGGCGGCGCCACGAGACGAAGACACCCGAGGGTCACGTCGTAAGCCGGGCCTAGTCGTGTGG
CCGACGACGCCAGTCGCCAGCGACTCCGAGCCTCCAGCCAAGGCTCCAGCCGCCGAAGAGTGTTATCACATCTTCGACGGCGTGACCGGTAGTCGGGTCA
AGACAGGAGCTGTCGAGCTTACAGCTCTGCCCGAGGTTTCAGAGTTGCTGAACCTTGAGGAGCTCGCCATGGAGGACTTCTTGGCCGAGCTAAAGGCCGG
GGAGATCGCAGAGTTGGTTCTCCTCCGACCGGAGTCCACGTCGGCCGAGTTGAACTCGTCCTCGGTCATGGACCAGGCAGTCCTGGAGGAGTTCCAGAAA
CAGCGCGCGTCGCGCATGGGCTCTGAGATTTTTAAGAACCCCCGGAACACGGTGTACCCCTCGGTGAAGGAGTTTGAGGACGTGGTGTCCAAGGATCCAC
CGTCCAATCTCCCTCCGGACAGGGGAATCAGGCACGAGATCGATCTCGTGCCGGGCACGAAGTACTGTGTCACGAGGCAATGGCCTCTTCCCCGGGAGCA
GTGTGAAGTCATTGATGCCTTCTTTGCCGCCAAGGCAAAGGTAGGCATGGTGCGGGAGTCGAAGTCCCCGCACTCGACGCCTACCTTCTGTGTTCGCAAA
CCGAACGGAAAGTGGCGTCTGGTTCATGCTTATAACAAGCTGAACAGCGCGACAGTGCCTGCGCAGACACCGATCCCGCGCAAGGACGTGTTGCTCAACA
ACATGGCCGGCTGCACGCTGTATAGCGCGCTGGACCTGGTGGACGGATACTACCAGATCCTGATGCGCGAGAGCGAAATCCCACTCACTGCTGTGAGCAC
GCCGAGCGGTATGCTCTGGGAGTGGCTGGTCATGCCTCAGGGGCTTTCTAACGCCCCGGCAACGTTCAATCGCTTGGTCACACAACTGTTCCGACCTTTG
CGTGCGTTCACACAGACGTACTTTGACGACATCTTCGTCCACAGCCGTGCCGAGGCAGGCCAGACGGCCATGGAGGTGCATCTCCAGCACCTTCGACGTG
TGTTCGAAGTCATGCGGGCGAACAAGCTGTACGCCAACTTCGACAAGTATGTATTCGCAGCTGAGGAGATCAAGGTCCTGGGCTGCTTCGTCAGCAGCGC
CGGGGTCCGGGCGGACCCGGAGAAGGTGAAAACCATCGCGGCTTGGCCGCCACCTCGGTCGCAGAAGGACCTACGACAGTGGTTGGGCCTCGCCAACTAC
CTGCACAAGTATAGTGCAGGCTACGCCGAGCTGGCACGGCCCTTGTCGGATCTCCTGAAGAAGGATGTCGACTGGAGCTGGGAGCGTCGCCATCAAGATG
CTTTTAACGACATCAAAGCGAGCTTACAGCGCGCGCCAGTCCTGGCATTGCCGGACGAGACGAAGCCTTTCAGCGTAGTCTGTGATGCGTCTGACTACGC
AATTGGCTGTGCGCTATTGCAGGCCGACGATGAAGGCCGCGAACGGGTCATCTCGTTCCAGTCCAGGCAGCTCAAGGCGGCCGAACGGAACTATCCAGTC
CACGACAAGGTGCTACTTGCCATGAAGTACGCTCTTGTCAAGTTCCGAGTGCACCTCCTGGGCTCGACGCCCTTTGTCGTTTATACAGACCACACGTCCT
TGCGGACTGCCGTCAACACGCCGCATCTCTCACAGCGGATGGCGCGTTAGCTGTCATTCTTCACGGAATACAACTTCCGTGTCGAGTACAAGCCGGGCAA
GTTGAACGTGCTTCCCGACGCGCTGTCGCGCCGACCCGACTACGAGCTTGCTCATATTAGTTGGGTCACGACGGATCTGTATGATCGCATCAAGCTGGGG
TACCGAGACGATGCCAGTCTCGAACCTCTTGTGCGGTTCTTGGCCTCTGGCTCGGAAGCCAAGGCCGAGTGGCTCACGCCCCGACAACGTGCAAGGCTGC
GCCGCTATGAGTGGGCTGACGGTTTGCTCCACTATAGGGTCGAGCCCGAGGATCCTCCCCGTATTGTCGTGCCCAACGACGAGGATCTCAAGTACGACAT
CCTGATGGAGGCGCACGACGCTCCATCCAGTGGCCATCTCGGCCGTGAGAAGACGTACGCGTCTGTCTCGCAGATGTTTTGGTGGCGTCACATGTACAAG
TGGGTCGCCACCTACGTCCGTACGTGCGAGACGTGCCAGCGCGTGAAGCCTGCCGGTCACGCCTCGGCACCATTGCAGAGCCTGCCGGTCCCAGCGGACT
GCTGGAAGTCGATGAGTCTCGACTTTGTCTTCGGACTTCCGGCCGATGACCGTGGCAACACTGGTGTTGTTGCCTTCGTGTGCCGTCTGAGCAAGATGGT
CCACTTTGCTCCAGTTCGTGACACCGTCACTGGCGACGAGGTCGCTCGCCTGTTCATGGACTGTGTCTTCCGACACCACGGTCTGCCCGAGACCATTGTC
TCTGATCGAGACCCGCGGTTCACCGCTACGTTCGGGCAGATGCTGTTTCGCCTTCTCGGCACACGACTGTCGATGTCGACGGCGGACCACCCGCAGACGG
ATGGCCAGACGGAGCGCGTCAATCGCGTGCTCGAAGACACGCTCCGCAGTATCTGCGCGGAGATGCCCCGCTCTTGGGCTGATCGCTTGCCCATGGTTGA
GTTCGCACTCAACAATGCGGTACATGCATCGACGGGCTTTACGCCCTTTTACCTGAACGGGTTGCGCCACCCTCAGGTGCCGCTCACATTACGAGGCAGT
ACCGGGGCTTCGGTCCTAAGTGGGGGAGAGGCTTGGAAAACTTTTCCTCCCAAGTCTCGGACGTGAGTCCAGCCACCTTACGGAAGCAACTGTCCTCGTT
TGCCGAAGACAGGCTGAACATAATCAGCAGGGTGCGAGACACCATGGCGCAAGCCCAAGATAAACAGAAGGAGTACTCTGACCGAAATGGAAGAGGAAAC
ATGAACGTGTTTAAGGTTGGGGATTTAGTTCTCCTAGATACTAGAAACCTACCGCTAAACACTGTTAGCTCGGTCGAGAGCAACAAGCTGAAGCACCGCT
TCATTGGACCCTCCACGGTCCTCAGCCGGCATGGCGCGGCGTATACCATAGACTTGCCCAAGTCGATGACGACTCACCCGACGTTTTACGTGGGTCGTCT
TAAGAGGTACCATGACCCTCTGGCTCTGGCTGCCCCGCAGGAAGCGGTGGGTGGCCCGGTGGAGAAGAGCGCAGCTCCTCGAAGCGCGGCGTCGAGTCGC
GGTAAGGCGCCTGATACGCGCGCTGGTCGTAAGACGGCTGCGGCGTACATCGGAGCAGTATACGCAGGGGCCCCGTACGAGCCCTGACCAAACTGGGCCT
GATACGAGTGGGGCTGCTGCTGCTCCAGATACGGCGCGTGGCCATGAAGCTCGGCCCGAAGGCCAGCGAGCTGGTTTCGCAGCGAGTCGTAAGACGACAG
GTCGGCTCGACGATCCACACGGCCATGGAGACTGCGAGTTTCGTGATAGAGCGAGGCAACATCCTCACGGAGCCGCTCCACGGCACCAGGCTGACCAGCA
CGAGCGGCAGCCTCGCCACCAAGGCCGACGCCAAGCGCGATCTCGAGGACGTACACACGGTCCCGGAGAAGACGAATCTCCTCTTGATGCAGGGCCACCA
CCTGACTCGGGGCCCCAGCATACGGCTGCGTCGCCTCAGGCTCGTAGCTATGGCCGTGCGAGGCCACCGCCGGCCCTCCTTGATCGTAATGGGCAGATCC
ACTACCACGTGGAACGAGTCGTCCGGGAGCGGCGGCTCCATGGCAAGCGCCAGCTGCTCGTGAAGTGGAGGGGTTACCCTGAGTCGGATAACTCGTGGGA
GCCCGTTGAGCAGCTCCAGGCAGACTGCCCGAAGGCTGTTGCGATATGGGACGAGAAGCAGCGGCAGCTTCGTAAGTAGTCCTTGGCTTCTTGGCTGGTA
CCCGGGGCACGGTAGCAGACGTAGTCGCACCACGCCCACGCTCTTCACGAGTTTTGGCTCTCGCCTCTTGCTTCAGCTCGTCCATCTTCGAGTGGAGCTT
GCGCTTGCTCACGAGTTGAGCGAACTCGATGCGGAGCTCGCGCACGTCCAGGATTGCGGACAGAGTGCGATCCTCACGGAGTTCTTTGAACTCTTGGTCG
GAATACCCTTTGCGCTGGACGTAGCGCCAGAAGAGGTTTCCACCTCGCCAGGTCATGTTGTCATTCGGCTTGACCCAGTGGAAACCCCACACAGGATGGA
GTCCACCCTTGTCCTCCGGCTTCTTGCGAAGCGTGGTGAACTCCATCAGTGTGAGCTTGTGTGGTGCTAGCAGCACACACCGGGCGGCTTCAACGTCGCC
AAGAAAGAGTGGCTCTTTCTCAACAAGAGCACGCTCATAGGAACCCCTCGAGGTGTACCCGCCGATAAGGCCACGAGAAGCCGAGAGCTCTCCAACAGCG
CTGGCGCACCAGTGCCAGGCTCGGGTGGGAAGTAGCCCTGCGGGTACGTGGCATCCCCGCCTGAAGAAGACTCGATGGCAGTCGTGGCAGTCGGCTGCCT
GGCATACGCACCCGAGCTAGCAGCGTGGTATTGCTGCTGCTGCTCGTCGAGGTTGTTGGAGAGCTCCTTGGGCTCGTGGACGGCACCCTCCTCGTCCTCA
GACTCCGAGTCGATGAACAGCTTGGAGCTGGAGCCTCGAGGCGACCTGGAAGCTGAACGCTTCTTCGCCTTGGCCTCGGCGGCCTTCGCAGCGGCAGCCG
CTTTCGACGCTTGGGCACGCTCACGACCTTGTGCCAGCGTCAGATGCTTGGATGCCAGCACCTCCTTGGGCTTGGAGCCCGCGTCGCTTGGCGACTTCTT
GGCCACGACCCCAGCGTCGGCCATGGCGACTTCGTCGTGCGACTGCTTGCTGTCGCCTGAGCCGGACTCGGCGTCCTCCGCCTCCTTCTCTGACGAGGCC
TTTGCGTCGGTCGAGGCGTTGGTCATGTCGCCTGCCGCCAGCTCCGTGCCTTCGGCAGCGTGCGTGCTGCCCTCCGAGACGTTCTCGTCGTCGGGTGAAC
TCTCACCGGAGTACTGGACCATCGTGCAGTCAAAGACGGCGGCTTCCCAGTCGCGAGCCGGGCTTTTATGGCCCCGAGGACTCTCCTCCTTGCCTTGCGC
GGCGTCAGGAGACTTGCTCCGAGCCCCGGCCTGACGGCCACTCTCCGGCGTGCTGCTACGAGAGCGCACCACCTCCTCGGCCGCCTTCGTGGCCTCCACC
AGCGCGGACGACTCGTCCTTGGCCTTGGCCGCCCTGGTCTTCGGCCCTACGGCCCGCGGTTTCGGAGGTGCTTTCGCACTGCGCGCACTGCGCTTTGGAG
GCATGCTTCCGGTCGACGTGGAGACCCTGCGGCTTGCTCGGCGATGCGCCAGTTGCTCTGTGAGGCCCGGGAGCCGAGGCGCCAGAGCTCGCGCCGTTGT
CGATGGATTTCGACTTTGCAAGTGAAATGTGAGTCGCCGGCGTAACCTCGCTCTGATTGGTCGATAAGATCGAATCTAAGTGGGGGAGGATGTAACGGGG
TTACATGGAATAGTGACCCTGTCACTATTCCGGGATGGCTACATCGGCCACTCCCCTGGATAGTGACCCAAGTGGCCTCAGAGCCAACAGATTCATTTTG
TATGACACAAACTATAGGGAACTTAGGATTTGTATGCAGGCCAAATCTGTACCAACCTATAAATACATTCAGTCTTAGATCTACCGCATTTCAAGTCAAG
TCGTCCCCTTCAGACCAGGGACACGTGAACGGCTGTTCACTTGGAGTTTGTATACTCCTGCTTCCTCTGTTAAGAAGTGCTGTGTGCCCCGTCACA