Description :
From Genome Similarity Track
Location :
Scaffold_8:283811- 286158
Sequence
2347 bases(100 bases per row)
GTCTGAGTTACAGCGCCTGTACGCCGCAGCGCACGGAGCGCAGCCGGCAGCACCAGCGCCAGCACCAGCGCCACCACGAGATGGTCGGGCACAGGCTGGA
GGCGAGCATTTCCAGCAGCAGAACCAAGGAGTCCGCTACCCGGACGCGCGACAGAAGAAGCTAGCGATTCGGCCATTCGACGGAAAAGAGTTGTACGTGG
GACTCGAATCTGGATTCCTCAAGTGAGGTCGACGCTTCGAGAGACAAGTTGCGTTGGCGCAGTCGGCATGTGGGTTCGCGTGGCCGGAAGATGTGAAGGT
GGATCTGCTGGGGCATTACCTAGCGGGGACTGCAGAAAGGTACTATAACAAGCAAGTAGATGCCTGGTGGACACAACTGCCCACACTGCAATACGTCATG
GAGAGGATGCTCGAGACGTTCAAGACCAACATCACCCCCGCGCAAGCAATGAAGTTGCTCACTGCGCCGAAGGAAGGCAAGAGATCGTGGCCCGAACACT
ATATGTACTTGGTCGCCGTATCAGAGGCATGCGGTGGCGGGGCAGACTACCTTGTGTTGAACAACATCGTGCAGTACGCGTCCGCGGACTTGCGTACAGT
GCTAATGGCCAAAGTAGATGGGACAAGAGCGGACTACTTGCAGCAGGCTGAGGAGCTGGCGCACTTCGCGCAAGCCTGGGAATTAGAACCTGCCAAGCAC
AAGAATCTCGGCAGAGAAGTCGTGGGCGCCGTGTGGCTGAGCGCCGCGGCAAGGAGACACGCACCTGCCATGAGTGCGGGAAAGTCGGACATCTGCGCGC
AGCATGTCCTGAACGGACGCGAGGGGGCGGCAGGAAGCCCGACCTCACGCTGTCTGTAGGAGAGACGTCGGTCGAGTCCGACGTGATGTGGATCTTGGAC
AGCGGGTCCAGTCGGCACTTCGTGAGCGATGCGTCGTGGCTGGATGACGTCGAGAAGTACTTGGATGAGTGTGTACAGCCAGACGGAAATCCACTCAAGA
TCAGTAAGAAAGGAACTCTCACGCTGCGCGTCATGGCGAGCGGGACGGAGCAGATCGTGAAGCTCATGGACGTGTATTACGCCTAGAACGTTGTGCACAA
CTTGATCTCCTACGGCGAACTTGACAAGAAGGGGGTATACGCTGACATACAGAAACGGACGACGCGTCGTTGCCGGTATAGACGGAGGGCGAGTAGCATT
TGACGTGGATCTGCGGCATGGCGTGCTAGTCGTGCCTGCCGTCGTAGAGCGGAAAGGAGGAGCCCCATCGGGAGTAATCATGGCGGCTCTTGATCAGGCT
GAGGCTGAGGCCGAAATGGGGTCGGATGACGTGCAGAAGGACACGTTGGTGGAGTTCCACAAGAGGTTTGGACACTTAAGCTACGACGCGGTTGAGAAAC
TTGCACGGGACCCGAGCTCGGGCATCGTCATCACGGACCACCGCCGCGTCAACTGCTTAACCTGCGCGCAGGGGAAACAGACGAAGAACCGGCAGTCGCA
GAAAGATACTGGGGACCACTCGCCGATCGATCGTGTTGGTGGAGTAATCTGCTCGGACTTGAAGGGTCCGATGACGCCGCGAGATCGTCTCAATAATCGC
TACATGATAAACTTCGTCGATCATAAGAGCAATTACTGCAGAATGTTCCTGGCGCGAACGAAAGATGCTGCTGCCAAGCAGTTCGAACACTTCCTCACGT
TCTTTGAGAAGCGTTTCGACTGCAGGATTCATGTACTGAGGACGGACTCGGGTGGAGAGTACCAAAACGTAGACTTATTCTGCAAGAAGACCGGGGTAGT
GCGTCAGCGGAGCGAGGCCAGAAATCAAGCCAGCAACGGGAAGGCTGAGCGCATGCATCGGACCATATTGAGCATGGCACGGTGCATGATCTTCGCCTGT
GGACTGCCATTAAACTTTTGGGGGGATGCTGTACAGTACGCGGCCTACATTCTGAACAGGTTGCCGACTAACTCGAACCCGGGCAGAGCTTCGCCGCTGA
AGATACTAACGAAGCAGGCACCGGCACTAGGCGAGATCGTCGTTTTTGGCTCCCCGTGTACTGTGTATAGAGAGACCCGCGGAACAAGAATTTCTCGCAG
CGTGCTCAGCACGGCATGATCGTCGGGATTGAAGAAGAAACGAAAGGGTACAGAGTTTACCTACCAAAGGACCGCGTGGTGGTCACAACACAACACGTGA
AGAACATTGAGACGCTTAACAAGACCCAGAACAAGCAAGTGCAGCGGCTGTATCTGCAAGAGGATGACAGTGCTGTCGTGGATTAGTCCACGAGTGGATC
TGCGAGCGCCGCTGAGGCGGCCACCACTGAGAGCGCGTCGGCCGGGA