Description :
From Genome Similarity Track
Location :
Scaffold_200:28376- 29681
Transcript NameFunction/comments
Phyta_totarag5475HECT E3 ubiquitin ligase, putative

Sequence
1305 bases(100 bases per row)
TACTCGAAGCCAAAGCCAGTGATTTCCATTTGAATCACCTATAGACAAACAAACGATTAGTTAGAAAATGACACAAGAACCCAACAGCGCTCATAACCAT
GCAGGGCATCACAAGATACTTACCAGTGATAGATACGATTTGAGATCATCCTTGGTCTCATACACGGGTAAATCGATGCGGTTAAAACAAGTGTGCGCAC
GCGGACACATTCCAAGTGGAGGTGTGCCTAGAGGTACCATCTGCAGCGTGAACGGATGCACAATACCGCTGGCGCTCGTGAGCGCTCGGAAACCCTCCAC
AGGTACACGTGAACAGCCTGTTGCGAACTGCAATAGTCGAGCACGCTGGTCGTCTGTGAAGGAGCCAACCACATCCCAAAACCACTGGAGCACCTCGAGC
TCTTGCTCGATTCCTTCTGAATCGTCGTCTTGGGTTGCATGTCGAACGCGCGAGTTGTTTTGCCAATCCGTCACATTTAATGTGGGTAGTCCACTGAGAT
AGAAGTCCAGCTCCTGATAGTCGAAGATAGTGAGCAGCGACTTCGGGATGACATCGTATAGTCCCTTGAGCAGCGCTGTGAGCTGTTCAGCCACGCTATC
CAACATGCGGTAGCGCAGCACGAGTGATAAATACTCCAGCTTGTTTTCGTCGGTCACATCAATATTACTTCCTCCAGGTTtcagctccaccgtctcACCC
GACGGTGTTTGAATACTGAACGTCACACACAGAGCGCCCACGTGATCATTGTCCCGCACCCAACTCAAGTGCTTATAAAGTTCTTCGTCCAGAAATTCCA
GATCGGAGAAAGTGATGGGGACGCCCAAAAGGTGCTTCAACAACGGCAGCGACATGCTTACTTCAAGCACAAGGCCGTCCAAAATGGCCTTGCCCAGAAG
TCTGCCGGCGAATGTGAAATACTGCACGTGGTCTTGGCCTTCGGGCACACACTTAGCCGATTCCGAGTTGATCCAGTAGCTGGAGTCCTCCGCATGCGTC
GTCACAAAAAGACCTCGTTCGGCGCTAAAAAGCTCTTTACACACAAGTCCGAACCACTCGCGCAacacaccaccagcatccaGGGCTGGTTCGCCGATAA
AGCCAATGTTTAGGTGCTCCTGCATCCTCGAAATGTCGACGTCATCCCCGGCCAACTGCGGTAAGGAGTCGTCCAAGATGGCAGAACGTAGCACATCGAT
CTTGAACATGGATTCAGTGTACGGCACGGAAAGATTCGTGATCTGTTTGAGGAACCAccgcttcttctctctcCACGTCATCGCCAGCACGCCTTCAAAG
TCCAC