Description :
From Genome Similarity Track
Location :
Scaffold_127:28372- 31245
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_127-snap-gene-0.35KIF4B
Pytap_DAOMBR444maker-pag1_scaffold_127-snap-gene-0.23Ubiquitin family protein

Sequence
2873 bases(100 bases per row)
CATGACTTCCAACTGTTGTTTGAGATATGTCACTTGGCTTTCGGCTGTGAGTGTTTGGTTGATCACAGCTTGATTCTGGATGTTTCGAGCACGCGACGCA
TATCGCAAaGTATTGCACGTTTCCTCGAAGTTGACATCTGCTGGACTGACGCAAGCAATCATCAACGTTTTGCTGTTTCCACCGAGgGAGTCTTGCAaCA
ATCGCGTCAGTTTGGAATCTCTGTACGGCACGTGCGCACTCTTTTCCGATAGTGCGTTGATCACGTTGCCGAGCGAAAGCAGGCCCTTGTTGATGTTGAC
ACCTTCCTTGAAGCGCGCTCCTTCGGCATTCGTTCGCTTGGCACGCTCTGACCCAGCGAGATCCACAAGATGGAACTTGGAGAACTTGGTCTCGGCGCCA
AGTTCGAGGGTTGTCTCGTACTGCTCCATTGTGAGCGTGCAGATAGCGTGCGAGCGACTCGACTGGGCGTTCATGTTAGTGGAAGCGGTCGCACGACTGA
GGGCACCGGCATGTAGCAGTGTCGCGACCTGTTCAAGAGATTCGACTGCGTGTTCAGACAATCCGTTGACGCAGATGCCGCGCTTCCCATCGTCCCGTAC
GGACAGCGATGCAGCGCCAGCAGACGACGTAAGGAGGTCGTGAATTTCCTCATTCAGGATCTCCAGGTAAGACACCTTGAGCACGAACTTCTTGTCCTGT
GATGCACTCGCTATGCGCTTGAATATCTGCACATGATGCCAACCCCcAACATCAGCCCACTTGCTGTGACTTCCCgATtGCATCGATCAGCACTCTTTAC
CTCGTCCATAGTTCGAGGGATAATGCCACGTTCCGCCGGGGCAACACTGAGCTTGAACTCGTTTCCCATGGTGAACGTCTTGCCCGAGCCCGTCTGACCG
TACGCAAACACTGTGGCGTTGTATCCATCGAAGAAGCGATCCACTAGCGGCGCCACAAGCTCCGTGTAGACCTCATGTTGAGCGACTGTCGGTGGGAAGG
CGGCGTCGAAGTCGTACTGCTTGCCGCTGAGCCCGCCCACCAGCACGGATGCAGCGCCCAGCACCGACACACATGCCTCGCTTCCCTGTGCACTCTCTCC
AGCACTCAGCGGACGCACCCGCACGGCCACCTGCACGGCGCTGCTTCCGCTGTCATCACCCACACTCTCTaTCGCCATTGTGGAGCAAGAGGAATGTTGC
CGCCCCaCCAATGCGCCAACGTTCAAAATTTGAACCCGTTAAGTTCGCAGCGCATTTTTCCTtGGTGTGATGGTGTGCAAAGCCAGTTAACTTAACCGAG
ACCTGTCAGGTTCGAAAAACCCaGACCTGCATCGATAGGGATAGGGGAACGAATAAGGTATATCTGGACGGTGGTTTTACACGCAATTCtGGGGAGgTTT
tGCCGAATCCTTCCGTAATCCCTTCTCTCCCAGCGTGGAAACTGCAAGCTGGCACTTTGTCGTCCGTCGTCCAAGTTCTGCGACGGCGTCATCCGGCATC
AGGCAGCAGCCGCGTAGAAGCGAAGCGGTCTCCTCCACACTGTGGACGCGAACGGTTCTACCGCAGATTATtCCCTGATTTGCGGACGCCATGATGGAGC
CTGAGAATATCCCCGAGAACAAACCGCTGGTGCGTTCCACGATCGCAAACTCGAGCATGGAGCTCCTGGTCTAACGTCTCCCTTTCTAAGCTGGCGACCG
AGGCAGCTAGTAACAaCCAGGCAGAAGCCAAGGCGGATGGACTGGTGGCGATCGCTATCGACGATGATGATGAGTTGCTTGTGCTCAAGGTCAAGACGCT
CAGTGAGAAACCGATCATCGTCGAAATCCTACCCACGGCGCTTGTCGGTGAGCTCAAGGAGACAATCAAGAAGCAGGCAAATGCGGATGGCAAGTTCCTG
CGTCTGATCCACCAGGGCAAAATGCTTTCGGACGACAAGGCATCGCTAGAAAGCTACAAGATCAAGTCGCAAGACTTTATCCACTGCGCAATCAGTGCTG
CCCcGCCAAAGGCTGTTGTGAACCAAATGTCGGCACCAGAGAACGAGACTGAAGAGCTGGATGACCCCGCACGACGACGTGGCTTCGATCGACTGAGAGA
TCGGCTTAGTCGCGAAGAGATTCAAGCACTTCGTCTGTACTTCTACCCACAGCTTTCGCTGTACATCAGCCAGGCCGAGCGTGTACCTGGAGAGTCGAGC
GAAGATCGGATATATCGGCTCGAAGAGGAGTGGATGGACTCACAAGGACCCAATTCCGAGTTCGGTAGGTGCTCGCCTACACGTGTTAAATGGAGAAATT
GCCGACTTACTTATACTTCCCTACAGCTCTCAACGTCGTACCAACTGCCCGTATGGCCATGGATCAGCAAATGGAGCTAAATGGTATGAACGGATCGATA
CTCGCAGCTGACAACGAAGGCACTGGAACCGAGTTTTTGTGGGGTTTCCTCATGGGATTATTGCTCGGCGTCTTCATGTTGCTGATGGTACGTGCATACG
TATCTCTCCTGTAGTGATTCACCGATACTCATCTAATTGTTTGTGTCTAGCTCCTCGATCGATCTGTCCCACGAAAGCAGAAGATTGGTCTGCTCCTTGG
TGTGAGCATGAACTTTTTCCTCAGCGTCATTCCCCGAGGCGTGACGGATCAGTGAGGACTTTTTGTTTTTAAATTTGCTTCCAACTCGACGCGTCTGATC
GACGCCCGTACATTCAAGTCTGCATTCGTCAGCTGTCGTTCGGCCGCATCGCTCCGCTCATTGGGCCAAGCAATGATCCCGTTCAACTACGGCATCAGGA
CTCtCGTGATGAGGCTGCATGTGAAGTGCCGACTCGCCGCGAAAGTGCTCATGCACGAACTCGGCTGAGAAAT