Description :
From Genome Similarity Track
Location :
Scaffold_1243:2837- 4432
Sequence
1595 bases(100 bases per row)
ACATGAGCCAACTCAGAATCCGGCCTGCGCGACAGCGCGTCCGCAAGGACATTCTGCCTGCCAGGCTTGTACTTCACCTCGAAGTTGTACTCCACGAAGA
AGGACAGCCAACGGGCCATCCTTTGCGAGAGGTGAGGCGACTGAGTCGCAGTGCATAACGACGCATAATCCGTGTAAATCACGAACGGCTGAGAGCCCAA
CAGGTGCACCCTGAACTTGACGAGCGCATACTTCATCGCAAGTAGCTCTTTGTCATGGACAGGATAGTTCTTCTCCGCAGCCTTCAGCTGGCGAGATTCG
AACGCCACCACGCGCTCGCGCCCCTCGGCGTCTGCTTGCAGCGGTGCACAGCCGATGGCAAAGTCCGAGGCGTCACAGACGACACTAAACGGACGAGCGG
GGTCTGGCAAAGCCAGAATAGGCGCGTGAAGGAGACTGTCCTTAATGGCCGCGAACGCATCTTGATGCTCGGTGTCCCAACACCACTCCGCATCCTTCTT
CAGGAGATTGGAGAGTGGCTGAGCCATCTCAGCGTAGTTCTTGCTGTCCTTGTGCAAGTAATTGGCCATGCCAAGCCACTTGCGAAGATCCTTCTGGTTC
TTGGGAACCGGCCAGTCAACAATGGTCTTGACCTTGACCGGGTCGGCCCTCAGGCCACGCTTTCCAATGAAGCACCCTAAGAAGGGGAACTCTTCCGCTC
CGAAGATGCATTTGTCAATGTTGGCATACAACTTGTTTTCATGCATGCATTCGAGCACAGCACGCAGGTGCTCCACATGGTTCTCCATATCAGTCTTTCC
GTGCTCAGCACGACTGTGGACAAAGATGTCATCGAAGTACGTTTGTGCGTACGCCCGATGGGGCCTGAGGAGCTGCGTCACAAGACGATTAAACGTCGCT
GGCGCGTTCGAAAGCCCTTGGGGCATCACCAACCACTCCCAGAGCATGCCCCTCGGAGTACTCACCGCAGTGAGAGGAATGTTTCTCGTCCTCATGAGCA
ATTGGTAATATCCATCGACCAAGTCGAGCGCACTGTACATCGTACATCCTGTCATGTTGTTCTGAAGAACATCCTTCCGAGGAATCGGCGTCTACGCCGG
AATGGTAGTGGCGTTCAGCTTGCTGAAAGCATGCACGATACGCCACTTGACATTCGGCTTTCTGACACAGAACGTCGGCGTAGAGTGTGGAGATTTACTC
TCACGCACCATGCCCGCCTCGTGCTTCGCACGGAAGAACGCGTCAATGACGTCACACTGCTCCTTCGGCAAGGGCCACTGCCTCGTCGCGCAGTACTTCG
TTCCCGGAACGAGATCGATTTCGTGTCAAACACCTCGATCCGGAGGTAGCCCCGAGGGCGGCTCCTTCGAGACCACGTCCTGGTAATCCCTTACCACTTG
ATACAAGGGATCCGACGGGTCCTTCAGGATCGCCGATCCGCTCCGCGCATTCAGCGCCTTCTTGGTGTCTACCAGGACAGCTTCATCCAGAAGCGAGGAC
GAGTTCAACTCTTCTTCGGGTCATATGACCACTACCTCAGCCAAGTCTCCAGCCTTCAAGGCTTCGCCGAACTCGGCCAAGGACATCTCACCCAG