Description :
From Genome Similarity Track
Location :
Scaffold_307:28369- 31439
Sequence
3070 bases(100 bases per row)
GAAGAAGGGAGAAAACCTCCTCCTCTAGATTCGAGAAGTCGAAATGGCGATGAGCGCCGCTATGCTGGGAACCGAGCAGCAGAACGCTGGCCTAGCCATA
TCAAAACTTGTCGGCAGAGCGAGGGAATGGATTTTGACATGTGATGCGTCTGTAGACGCCGCTTTTTCCACGTGGGACTCGCTTAAGATAAAAATGGTCC
GCGTGTTCGCACTGCCTGACGAGCCTTATCGAGTGCGTTCACACTTCTTATCCTCCCGACAAGGGAAAAGGGAATTACCGGACTATATCCAGGAGTTGAG
AACTCTTCTTGCTGCTATGCAGTTGGATCCCCTCCCTGAGGAAGTCCGTGTCACCATTTTTATGGAAGGAATCCGTACTGGGGTTGCTCGGACCGAAGTT
TTTCGTGTCCATCCCTCAACCTTTGAGGAGGTTGTGGACATAGCGTTAAACTCCGAGTTTAACTTTAGATCGGCTCGCTACAATACACATGGGCATGTTC
CGAATTCGTTTGACAGGGCTGAGCCCATTGATCCCAGTCATGCGGACGATGAAGAAGCCGAGCTTCAAGCTGTAGAACAGTAACGTAACATCCGTAGATG
TTACACGTGCGGAAGCACAAGGCATCTTCGCCCTAACTGTTCATTGCGTAAACCGCGACATAGTCGGCCGAGCCGTAATACCGCTCCAAATCAGAAATCT
GGTACGGTGCGAGAAAACGTCAACTCCCAGTAGGCGGGGGGGCTACTGGGGAGGAACAACGCTTTGTAGAGGCTCTAGGAGTTATAGCAGGACTTAGTCC
TACACGATCTCGTGGACGTAACTACGAATCGTGAATACAAGTCAGGCTTGTTAGTTGCATTGGCATCGGTTAAGGGCTTTGAAAAGCCGTGAACAATTTT
GATTGACTCTGGGGCATCGGGAAACTACGTCCGACGCCGTTCCCTTGAAGGGGGTCAACGGTATGATATAGCGCTGAAGTGCATGAAGTTGATTTTATCA
CGGTGCGTCTAGCAACTGGGGCCCGTGTCACTGTACCTAAAGTTCCGTTGAACCTAGGTGTAAAGTTTTTAGAATTGACATCATCGAACGCTGTCTTGTC
CTAGATTCGGACTCGAGATATGATCTCAATCTCGGTACGGTCTTGCTGGAACGCCATGAGCCATGGATTTATTGGAGTTCAAAGACCTTAGGCGCAACGC
ACAACGTTTCTAGTGAAGCTTTGGAGAGTCATGAACCCAGCTTTACTAGACAACAAAAGCGCTATTGGAACGAGCCACTGACTGAGTCAGTTAGTGTGCT
GGTCATCAGAATCTCTGATTAAGTTGACTCTGATGTCAATGAAAATAGTAGAACGGCACGTACTCCGTTTATTGACACGCGTTTTCACAACGAACCACTG
GATGCTAATAGCATTGATGGCCCCAGGTCGATTCATTTAGGGTGTGATCCCTTATATATACGTGGGGTGGCACGCAAACATCCACAGAGTGAGGGCGGCT
GCAATAGCACCTCACTGAATGTCTCAACTGACATTGTTGACGAAACGCTCCGGCATCAAGAGCGAGGCTCCTCTGATGCATGTGCAGTGGCACGTGAGCA
TCCACAGAGTCAGGGCGGCGGTCATAGCACCTCACTGAAATGCCGGTAATGGCGTTGTTGGCGAGATGCCCAGACATCAAGATTCTGATGTGCGTACAGT
GGTGGATAACTCGCCGGGTGATAATGTTCGAGTTAAGTAGCTCTGAACCGAACGTCGGTAATGCCATCAGCTCTTGTTTAGAGAACGCTAAGATTGACAA
AGCTAATCAACTTGTAGGATTAGATGTTCCGTCCTCGCTGAGGAGTTCAATCTCTTTTCAAAGACGGCAGCGATGCCAAATGGCGGCTGCGAGAAGAAAA
GCGTATGCAATGTCGCTTAGTGATACTAGAGATCAGCTATATTTACTGTTCGATGGCGTGACAGGTCACGTGGAGGGTGAATTCAGCCTTGCAGCCCTCC
CATCGTTAAACGTTCCGTTAGAGCTAGACGAAATGTCTGTGGATGAGTTCAGTCATACTTTGAAGGCAGGCGACTTATTCGATATGGTAGTCTTTAGACC
TGAAAACGAGTTGAACTCCTCTTCCCTCTTGGATGAGACGTTACTTAAAAGTACAAAGGCGGCACTTAGTGCACGTAGTGGATCAACCATTTTGCAGGTC
CCTTCATATCCCTACTAACCTTTGGTTAAGGAATTTCAAGACGTGGTATGTCACAATCCATTATCTGTATTATCTCCCGATAGGGGCGTACATCATGAAA
TTGACTTGATTCCTGGAACCACAAACTGCGTTACACGGCAGTGGCCTTTACCAAAGGAACAATGTGACGTCATTGACGAGTTTTTCAGTGCTAAGCACGC
GGCAAAAATGGTGCGCGAGAGCAAGTCTCCTCATATCCACGCCGAAATTTTGTGTCAAAAAGCATAATGGCAAGTAGCGTATTGTGCACGCTTATAATAA
GCTTAATGCGGCCACTATACCGGCACAAACACCCATTCCTAGAAAGAACATTCTTCAGAACAACATGGCAGGATGTACAATGTACAGTGCACTCGACCTG
GTCGATGGTTATTATCAATACGTGCGAGCAAGTGATATCCCGCTTACAGCGGTTAGTACTCCAAGCGGTATGCTTTGGGGGTGGCTGGTTATGCCCCAGG
GACTTTCCAATGCCCCGGCTACGTTTAATCGTCTGGTGATGCAATTGTTCCGCCCTCACCGTGCGCATGCACAGACATATTTCGATGACATAGTTGTCCA
TAGTCGGGCAAACCAGGGTTGGTTGGACGTGGATAACCACATCGACCATTTACGAGCTGTGCTCGAGTGCATGTGGCCTAATAAGCTCTATGCTAATGCA
TCGAAATGTATCTTTGGTGCGGATGAGATCCCATTTTTGGGATGCTTCATTGGGAAGCGAGGCCTTTCGATAGATCCTGCAAAGGTGAAGTCCATAGTAG
ATTGGCCAGTTCCTAATAATCAAAAAGACCTACGAAAATGGCTTTGTCTTGCCAATTACTTGCGTAAGTA