Description :
From Genome Similarity Track
Location :
Scaffold_1137:2836- 5816
Transcript NameFunction/comments
Phymu_g12802hypothetical protein
Phymu_g12803hypothetical protein

Sequence
2980 bases(100 bases per row)
CTTGCGCGAAGGCGTTGATGGCTGCGCCGAAGACCAGAGCCATACAAGGAAAGATAGCACCGTTGAGTCCAGCCATAATGGCGCCTAatacgagctgcag
cttatCGGACGGAGTGGCGAAGCGGTAAAGCGCCAGGAACGACAGGGACTTGTCGTCATGAGGTTGTTGAGCTGGAGATAGGGACTTGAGGTGCTTGTCA
TTGCGTGGGGTGTGGAGAGCGGCGTAAGGAGCTTGCGGAGACTTTGGGAGGGGCGACATCTTTTCCACTTGAGCCCTGCGCCGCAATTTGTCGAATGGAG
TGCGGACAAACTTGATGCGGAAACAAGGAATGATGGTCACTTTGACAAATTTCGCTAATTTGACGCAGAGATCTATGACTGAGTGATTTGCACTTGTCAT
CAGGATGTGTGCGAGGTAGAGATCAAGAGGAGACTGGGACTCATGTGACTGGCGGAGGCAGCGAGGCAAATGGCGCTCGGATGGCGTCGAAGGACATCGG
CATCCACAAGAGGCCATTCAATTTGATCAGAGAGCGTATGAGTGGACGTCCCACTTTTCACTTTGTCAATACGATCCATAGCGACGCAGAAGGGGCGTTT
TATATCGCAATCAGAGTTGTGGGATGATTACCCATGATTCGATCGGTTTCGGTTAATCGACCAGAATGGCAGAATTTGCATGGCAGCCTGCCATGCAATT
TTGGGGTCGTCCTagaacaaccgaaaatgaaAGAGGTTTTCAAAGGCGGTTAGGGTTacgaggatggatgtcatggccctcaaatcaTGAAAACGTGGCG
TGCCCGAGTGACTAAAACGTGAAAACGACTAATGCGTTCACAGGTTTGGCCTCAAAGAACTCATATACACGGTTGGAATCAGCCGTTAAGCCAAAAAGTA
CGGGCCGTGCATGCGTTCTTATAAATGAaggcgacattttgcttcggTCCACCTGGTTTAATTTCACCCTGTACCTCTAATAATCTAATTGACCTGTCGA
ATGTTATGTATACCGAAAATGCATCAAACTCTCACAGAAAACCCTCTAATTTTCAGtacattttcggttgttgcAGGGTGTTCCCAAATTTGGTTTGAGT
TGACAGTGAGCCACAAAATAAGCATTCAGTTTAGTGCTATTCTGCACTTTATCGGCCCGATAGTGAATTCAAGTGAATCGAAGGCCTCGCCCAGGTTGTA
ATTGGGATTTGGTTGTGGCCACTATTCGTCCTCCTGTTTGTGCCAATTCTCGTTAGATTTCCGATGCATTTGTATACAACACAATGCTTCATCCACCTTG
CGCATAGTCCCAGTGGCTTTTCACCTGTGTCTTGGCTTGGTCTTGTTTCCGCTGATGCCATTACACGGAGCTCCATCGTCGGGTGTAATTACCGCGTCAG
CCATTGCTGAAATGCGTCAAAATGACAGTCTTAGGTGTGAACGATGCTATAACAATCCATAGCAAAATACCAGCTAATATTACCAAAGATTCACTTATAT
AGCTGCGCCAGGTTTCGCCAATTACCTCACAGAATGATTGTCAAACCATAGCAAAACGCCAGTTAATATTACAAAAGATACACTTATATAGCTATACATT
TTCCATTATCAACTGAATTACGTTAGCTTAAATCAAATACGTAGCAATCCCATTGCCCCAACTATAAAACATTTCAGTGCATTACCATGTCCAGACAGGG
ATAATCATCATACCGTCGAAAGAATGCCAAAGTCAACTTTGACTTCCTCCTCATTCTCAAACTCGCCACCAAGTACTCAACCGAAACTGCTCCAGTATCG
CATCAGTGTCAAACATCTCCCAGTGCCTCAAAGCCTTTAACAATGGCGCCTCCACCAGTCAAAACGGACGACAGCGAATTCCCAACGTCGGACTACTCAC
AAGTGGTGACCCCCGTGTCGACTGCTAAAATCCAAAACAACTTCAAAAGGCAACAATCGgaagaccatcactctgatGACCAAGTATCCGACAccaacga
cgaagacttcaTCGAGACCGTCGCGTTCTCCCAATTGTATCGATACGCCACCCCCACGGACAAGGCTCTGCTCGCTCTGGGGGTCGTCATGGCTGGGATC
GGCGGCGCTCTGTTCCCGTGTATGGCTCTCGTGTTCGGCGACGCCATCAACGCGTTCGCCCAAGCGGACGGCGGCGTCGACCGAGACGCAGTGAACTCTG
CCGCCCTggacttcttcctcatctcCATCGCTCTGTTCGTGACGGACTACTCGTCTGGCGTTCTATTCGCTTACACGGCGGAGCGACAGGTGAAGGAGCT
CAGGACGGAGGTGCTTCGACACTTGCTGTACCTGGACATCAGCTGGTACGACCAGACCGACCCGTTGCAGCTATCGAGTCGACTGACAGGCGACACGGTG
AAGGTCAAGGACGGCCTGGGCCAGAAGTTCGGAGACGCCGTTCGCTTCAtctgccagttcttctcggGCTACATCATCGGCTTCGTGCGTGGGTGGGGTA
TCACGCTGGTGATGTCCTGCTTGATGCCGTTTATGGCTGGATCCATGGGCGTTCTACTGAAGATTGTACAGAAGCGAGCAGTGCACTCGCAGCAGATGTA
CGCCgaggctggagctgtggctgaaGAAACGCTGGGATCCATCCGGACTGTGTCGTCCCTCAATgctgagaagaaggcaaTCGCCAAGTACAACGAACGA
GCgttggctgctgaagagacCAACATTCAAGTGGGGAAACTGTCTTCTATTGCCTTCGGGTTCTTCATCGGATGCGTCTGGCTCATGTACGCCGTTGGGC
TCTGGTACGGCGGCTCCAAGGTGGCTCGAGACAAAACGTCACCGTCTGACGTCTTCCAAGCTTTCTTCGGAGTGTTGATGGGGACGATGTCCCTCGGTCA
GATCAAGCCTAACGTCTCCGCTATCGCTGAAGCcaaaggagctgctgctcagatCTACAAGATCCTCGACACGCCTTCCA