Description :
From Genome Similarity Track
Location :
Scaffold_1346:2836- 3865
Transcript NameFunction/comments
Phymu_g13141hypothetical protein

Sequence
1029 bases(100 bases per row)
CGACCGCCTCGACTCGCCGTCTCCCTTTCTACACCTCTTCATGCAACTGCATCACGCCGAATCGGTTACGGCTCACGTGATCCCGCAAGAAAGCACTCAG
TATTGCTCCACAGTTGATATTTGCCTCGTCGACCCAGGTCAGTTCTACGTAACCCACCCAGTGTACCAAGAATGCTCCATAGATCCGGCCGTATCGGGTT
CTTTTCCCACTTCGCATGTCCGAGATCCGTTCgacttcgtactcgtcggcttcgagaTCCGGGACCCAGCTGTCCTCCGGAAGCAAGACCTCATCAAAGT
CGAAGCGGTTCGCCTCGTCCACTGCCAGCCCGATCTGAGGTCGATCAGGGAAACTCCGCACCAATTTCAGTTTCGAGACATGGACAATCGGGAATATCTG
ATACCCGGTTCCAgtgatctcgagcttgatcGTGAATTCATTGATCTTTTCAGCAACTCGGAATGGGCCATGTCAGAAATGGGCTAACTTGCGGGCGTAG
CCTTCTCTCACCCGATCGAGATATAGCCAGACTCGCGATCCAACTTCGATCCGATGTGGTTCGACGTTCTCGTTGTGTCGGTCCGCTTGATCCGAGATCG
CGACCTGTAATCTAGCGTTGACTTGCTCTCATGAATGCAGATAGTACCTCTGAATCCGATAGCGCCATCTGCGCGGGTCGCAATCTTGGCGCCTGGTAGA
TCCGACTGGTATAGTCGCTTCAAGGGTGGATCTCGGATCCCACCCATGTACCAAGTAATGAGGAGTGTCTCCCCGGACTCGATCATGGGCCGTAATAATC
GCGAACGTCAACCGCTCTGTGTATTCGTCCCAGTCCCTCTGATCTAAATCTTGAACGTACATTTTGAGTGCTCGAGTCGCCGTTTGCACCATTCTCTCTC
CAGATCCGTTGGCTTGAGGTCGATACGCCATCGTAGCCCGCTGCCGTTGTCCCAGGATTTTGTTGAACGATCAGAAGAAGTCCAACATAAATCCAGGTTC
TCGATCATGTCGTATCATCTCACTCGCCC