Description :
From Genome Similarity Track
Location :
Scaffold_70:283547- 293625
Sequence
10078 bases(100 bases per row)
CCGTTTGCGTTTTTTGCTACTATAACGGCTAGGACACGCTGCGCCTCAGCAGATATCTGCTGTCTGCATTTGTTATTGTGATTGCCATTATCACCACTAT
TTTGGTGAGTACTATGCATGTAACGCTTCATATGACTGCACTAGATATTTTAATTCTCATACTAGAGATGCTCTAAGAGCATCTCCGACGGTTGGTCTCA
AGCACGGTTATGATTGATGTTGGCAACATCATCATGTGGCTATTGGTATTGATTGCAACTGCCACTGTCGCCGCCACTGTCAGCTACTGCGGCTGCTACT
GTCACTGCTACTGCCACTGCTTCAGTAACTGACACTGTCACTACCGCTGCTACTGCTACTGCTACCCCATTTCTACTTCTATTGCTATACTACTGACATT
CCACTATTGTTAAAGAAATTGCTTTTGATATTGCTGCTGTGGCGGGCGTTACTACTGGTCACTGTTACTGCTTATCCCTATTGCAACTACAACTACTAAA
ACTACTATTTCACTATTGTTAATGATATCATAGTAATGCTATCATTGACGTTGCTAGTTCATACCTCCTGTTATCGCTGCTGTCACTGCCGTTACCGCTG
TTATTTGCGCTACAACTACAATATCAGCATTGATAATGACATTGCAATGATATTTCCCCTGCTTTCTTCTTCACGCCGGAGAAAGACTGCCAAAAGCTAC
TTCATGTTTCTATTATATATTGCTGCATAATATCACTGGGCATCTCATGGCTTGCGCAAGCTAAATATACAAGGAGATGCCGTCTGAACATCGCCGTCCC
CACAAGCATTACCGATGATCTTAACTTCTTATTGGTCGTCTAGACTTTGTATATCACTCTCCTCTTTTCTAAATAGTATATGTAACTTGTATTGCTTCGT
TAGTAATATCAACACGAAGTATTAATATTTCTTATTCAGTAAAATGCTATTGGAATTGTTCGCCTGCGTCAAGATCACTGCCCGCTACCACTACAACTGC
CCTACTGCCAATGCGACCGCTACTGCAACCGCTATTATATAATGGCTTTGCTACTGATATTGTTATCGCTATTTCTGTTATTAACTTTTTTCTGCTCGCC
CCACGACCAGGAAGAAAAACTGTCAAGGTCTACTCCATGGTGCGTGAGTTGTTGCAACTCAGTATGATGCCATCCAACGAGACTTTTTCGCGAACCGCAC
CTGTTAAGATATCTCTATTTACGAACGAGCAGTTTACACGTCACCGCAGTTATGAAGTACGCGATGCAAATTGGCTTGAAGGTGCTAATTTCGCTTTGTT
ATGCGTTCATATTGCTATAGTTAGGTTCTTGCTGCAGCAAACATCACGCCCATCTAGTCGGACACTTTTAGGGTTAAAGTGCACCACCATGGCCATGAAG
GTGGCTTGTCCGTCTATCAATCAATGTCTCTTCTGTACCTACTGCAGCTCAATATGATGCGACGTCCAGAAAACACTACGTATACTACTGTGGTGCGACG
TCCAGAATACTACATACACTACTGTCGCGCCGTGCGCACTCCGTTTAGCCAACGTCACACAGCGCCGAAGTTCGCACACGTCATGGTGGCGTGTGAATTA
AACCGCGCATTTTTTTGCTTAAGTTTTATTTCAAATCCAAAACCCCGTTAAAAGCATCGATCCGGACGCTTCGCTGCTTTATACCGGTAATACCATGAGA
TTTTGGATACTCTAGTTCATATTAAAAGTACCGAATGTATTAAACTGATGGTCTGACTGGGGCGCGCTTCGCGTACGGGTCTCTAAGCGGAGGCAAACGC
ACCGAACAGTTTGCGTTTTTTGCTACTATAACGGCTAGGACACGCTGCGCCTCAGCAGATATCTGCTGTCTGCATTTGTTATTGTGATTGCCATTATCAC
CACTATTTTGGTGAGTACTATGCATGTAACGCTTCATATGACTGCACTAGATATTTTAATTCTCATACTAGAGATGCTCTAAGAGCATCTCCGACGGTTG
GTCTCAAGCACGGTTATGATTGATGTTGGCAACATCATCATGTGGCTATTGGTATTGATTGCAACTGCCACTGTCGCCGCCACTGTCAGCTACTGCGGCT
GCTACTGTCACTGCTACTGCCACTACTTCAGTAACTGACACTGTCACTACCGCTGCTACTGCTACTGCTACCCCATTTCTACTTCTATTGCTATACTACT
GACATTCCACTATTGTTAAAGAAATTGCTTTTGATATTGCTGCTGTGGCGGGCGTTACTACTGGTCACTGTTACTGCTTCTCCCTACTGCAACTACAACT
ACTAAAACTACTATTTCACTATTGTTAATGATATCATAGTAATGCTGTCATTGACGTTGCTAGTTCATACCTCCTGTTATCGCTGCTGTCACTGCCGTTA
CCGCTGTTATTTGCGCTACAACTACAATATCAGCATTGATAATGACATTGCAATGATATTTCCCCTGCTTTCTTCTTCACGCCGGAGAAAGACTGCCAAA
AGCTACTTCATGTTTCTATTATATATTGCTGCATAATATCACTGGGCATCTCATGGCTTGCGCAAGCTAAATATACAAGGAGATGCCGTCTGAACATCGC
CGTCCCCACAAGCATTACCGATGATCTTAACTTCTTATTGGTCGTCTAGACTTTGTATATCACTCTCCTCTTTTCTAAATAGTATATGTAACTTGTATTG
CTTCGTTAGTAATATCAACACGAAGTATTAATATTTCTTATTCAGTAAAATGCTATTGGAATTGTTCGCCTGCGTCAAGATCACTGCCCGCTACCACTGC
AACTGCCCTACTGCCAATGCGACCGCTACTGCAACCGCTATTAAATAATGGCTTTGCTACTGCACGAAGTATTGCAGTGCGACCCAACGGTTCCAGGCTT
GCTCGGACGTTGTGGTCGGGACGAGATGGGTGTTCCACTTGAACTGCATTACCCTGCTCCATGCCGACTCAACTCGACGCTCGATAGACCACACGTCATC
TTGCTTCACGGCGAGACCCTTCACGCGGGGGCTGAACCTTTCCCAAAGCTTGTGCATGATATCCCTGAAAGTAGAGCCGTTTGCTACGAACACTTCAAAC
ATCTTGCCTGAATTATCCCTCTTCCCCGCCGTGTCTTTGACGATAGGCTACACAACTAGTTGTAACCGGTGTTGCCCTGCATCATCGTGGTCTTCATTAT
CAGGCGAGGCATCGAGCGAGACGCGCGCTTGTCGGCACACGGGAGGTGCGGGAGGCGGGAGTGATTGAGGTGGAGTTCGAACACGTAGCGGGTACGGCGA
CACGCGAGTTGTAGGCGACGGCGTTGAACGCGGCGTCCTTCGAGCGGTTGTGTTGTCGTCGTCACTCCTGGGCTTCGTGGTCCGTCTTGTTGGCTTCCGC
GTGTAGCTGTAGCTGCTGCAGGCGTGGCGGCTTCTTCGACTTCGACGACCATCCGGTCTTGCTGCTGTTTGGCGCTTCTGTAGTGTTGCGTACATAGATT
ACACTGTGTGGTGCAGATATAACCTTTATAAATGAGTTACTTATAGAATAGTGAAGGCTTGCGCGATTTGGTGCGCGGTTGATTCGAAGAACCACGCATG
GAAATGTTGAGTAGAACGCACAATATCAATAGCATGAACACATACCGCATGTCGACATCAAAAAGCTCGTTCCGCAGCCCAATATGTACGATGGTGTTGT
TAAACTACACCATTGCGCTCATCTGAGGGACCGACTTTGCGACTACAATCTTGCGCGCGGGATGTTCTTCTGACGTTTCGACTTCTCCTGGACGAGCGCC
GGGGGAAAGCCCTTCTTGTTGGTCTGGATGATACCAACCTTGTACATGTTGCGCTGAAGAAACTGCAGGGCGCTCTGGATCGACGTGTAGAAACGGTCGG
TAACTACCGCATATACTTGGCTGTCTGGTGGGAGTGTGCGGCACCGACGTTGCGTCCTCTTTCTGCTCTTCGTCACCAAAGTCTGCGCCGTGGTCCCTTG
TGCCGTCGATGTATTCGCGATGCTCACGCACGAGCAGCTCTCAATCGACGCCCTTCCCCCCCCCCTCCAAACGGCGAAGAAATGCTTCGGCCCCGCGCCG
GGTCATACGACGCGCCGGCATTATCACTTGACCCTGAAAGTTATTGAATGAGCGAGGGGGATTCAGCACCCACCACGCATCACTGTGGGGGGGGTTATGA
CCTGTCCATGATCAGGGTGGATGCATGGAACTTTATTCTGCCGTTGCCACCCCAAGCCCTGTGCATCCAGTACCAAATTGGACCAATCGATCGTTTTATG
GTCTTTTCACATGATTGATATCAAGCATGTGGGAACATAATATGTGAAAATTACCGTAAGGCGTCCATATTATGCAGCTTTGCCATCAACAGACAGTCAC
AGGGACGAGAGGTTGGTCGTGGACCTGAACGCGCTGAGTGCCTCGCCGCTCACCGAACAAGAACAGCGGGACATCATGGCGACGCGGGCAAAGACCGCCA
CGAAACGATTTGTGTTAAGCAATTACGTGGCCTGACGACGACGGTGGTGCGTCCCCGGCGGCGATAGTAGAAACGGTTGAGGCGGAGATGAGTAAGCGAG
ACGCTAAGAAGGTCAAGGTGCTGCACATGCAGGCAGTGCAACGCACGACGAACGAGCTGGACGCATTGGAGGCAGTAAGACGGGCGGCAAAGGCGGCCAA
GCGCCGTGGACGAACGAAGCAACGGCAAGTTCGACGAGTAGAACAGGCTCAACAACCTGTTGCACCTATCACCGAAGGCACCATCAGTACAGTTACGTCA
AAGAGACTATTGAGTGAGGAAGCACGATCGCGACATCTCCAACCTGGCGTCTAGGCCGAGGGCGATGTGTTGATGCCAGAGCCGAATGATGCGTTCCGTG
ACGCGATGAAGTGGACCGTGAAAGCGGTGGTCGCCGCCGAGGAAGTAAGGGCTCGACGACGGACTCTACAAGATGGATTAAGTGCTTTGGCTCGCGCTCA
GCTCGAACGCGGTGAGTCTTTCGCAGCTGGCAACGTGGTTGGCGACAATGCCATGCGTGAAGGCGTGGCCGTACAGCTGGTGACTGCGGCAACAGGGTTA
TAAGCAGTTGGTGACGGTGTTGAAGCGACAGACGATAACGTACCGCTCCACGTTTCCAGAACTAGACGACGCTTTGAGAAGCGTGTACGAAAGGCACGCG
CGCAAGAACGGCGAGAGCGCGTTGCGTGGAACCAGATGCATGGCTATCCCGCTGCAGCATTTTTCGACTATAATGAGCATCTTCGAACTGGAGGGAAGGC
GAGAGTCTTGACCAAGGAGGAGATCGATGCGATCAAGTACGCGCTGCCAACGGCGACGGAGATGCTACGGAAGCTAGGGAAGAAGCCAGTGAAATGCTAC
AGCTACCATAGTGGCAGCAAATACGAGAGTTGCCGCAAGGTGAGGACCGAAGACGGCAAGGGTGAGGTTAGCGTCAGTAAACTTCGTGCCGTCAGGCCCC
GGCGATTGACCTGCTTCCTACTGCTACGCTGTCGATTCGAGGCCAGTGGCGGCATGTCAAGTAGGATACGGGAGCTCAATATTGCGTGGCAGTCGAAGGC
TGGAAGTGCTCGGGCACGAAGCTCAATGTACAGACTCCAGTTGACTACATGAAGGGATTTAGTGGGGCCGTGGTTCGTGTGCTGGGCGTGTGGCGATTTG
CGTTCCGTACACAGTACTTGCAGCCAATGACGGTGGATATGTTGGTGGTCGAACACGAGACCGATGACTTTTTACTAGGGGAAGACTGGATGTACGACCA
TGGTGTGCAGCTGGACTTTGTGAGCGGCGAGATGAAACGGTACGCCGACGGGACCAAGTTGATCGTACCATTCACCGGCATCGGCACCCGTGATCAGCGC
GCTCAACATCAGACGGGTGGATAGGTATATCTATATGGTTACTATTCCCCGACCACGGAGTGAAACCAAGCATCACACCCTCGCAAAGTTTCGTAAGTGG
TTCCTAGCGATTCTTGTAGCTACACCGATGTCTGTGCGAGACACCTTCGGGGTCAGCAGCGTTTTGGTGACGCTGCGTCACGAGCCAAATCTATCGGCAC
CGTATGAGTGGAGGAGGATTGCACCGGAAACCGTGAAGGGCGTCCCGCGCGTGGGAGCGGCAGCGGAGGGAGCGGCAGCGTTACTACAGGAACCCGACGG
GATTAACTGGTCCGATGCTAGCGTGCATGGCAATCGTGAAGTAGATCGGGACGGAGCGGATATGGCTGAGTATGCTGCAAATAAAGGCATCGTGATCGAG
GCAACGCCACTTTTGCATGGCTTTCCCTGGTTAGTTCCCGAGAAGGTAAGGAACAAAAGAGTACTACAAGCGCTCAAGAAACAACCATTTAGGCAGTTCC
GATTGGGGCTCGGAAAGCATCTAGGCCCCCTAGTGGACAAACTACACTGGAGTAGTCCGAATGGGTGAAGGCGACACAAGACCAGACACCAACAGAGCTG
TGGGCTCGACAGGATGTTCTGACAGAATTTCAAGTCTGGACAGCGTACAGGGTTGCTGTGAGTCAACTGAATTTGTATTTTCCAGGGCGTGAGCAAAGTG
CACACTGCAGGATGACACAAAGCTGCGAGGGCCACAAAGAGACATTGGAGCACCTCCTATGGACATGTCCGTACGCCGAGGCGGTATGGATGATTTTCGT
GGAGCATTGGACAGGATCAGCAGTAACACAAGTGGAGCTGGCGAAGTACCAGCACTTTGTTGCTTCGCGATCCCCACCAGCCCTCACAGCTCGGTTCAAG
CAACGTTTTATCGCCCTATACGGTGAGCTGACACCAGAGCATACGCAAGCGGCGCGCTGCCTATGGTGGGCCTTCTGCAGCATCGCAACAGCATCACTCT
GGATGACGCGCAACAGAAAAGTTCATCGGCAGGAACTGGTCACGGTGCAGCAAGGAAAGACAGAAATCTGGAAGACCGCATTACGTCAACTTCGGGCAGT
AGCCCACCGAGATTCCAGGAGTATCGAAATCCGAATGTTCGGCTTACGGCTACAACAAGTGATTGATTGCTTCGAATACAATGATCCGCAACAAGGAGAA
GAACACATCCCAAAAGCAGAGAAACCACGCAACAAACCTCCGATTGTGAAGTGGCTTAGGATTTTTCAGGACGCTATTAACTAAAGTTAAATAGACAACT
GTGATCATCATCATCACCTTCCTGCCATGCATATTGCACACTGGCGACGCATTTATTCTCAAAGGGTGTGTCACGTAGTGCCGGGAGCTAACACATGCCT
GGCACGCAATTGTCGTGATGTGGCGAAGCAACTTGACATTTTCCTGATTACCGTTGCCCGGTGGCTCTGACAAGAGTACTCGAATGGTTCGTGTGGGAAA
GAAGGGTTGATTCAGGATGGCGTGCCTGTGGAACGCCCGAGCATGATGGAGGAGATGTGGAGTATGGATACCTGGTCGCGTTTGACCTCAACTGACCGGA
GGTGCGCAGCACCCAGTCCGGCCCCGAATAGTCTGACGATGGGAGACCGTGAAGTGCCCCGGTGAACGTATCCCGGAGAGCTACCCTTCTTGGCGAGGCC
AAGGCATCCCAAGGTACTTCGAATCCCCAGCAGCCCGAGTGTGAAGCTACTCAAGTGTACCAAGCCATCGACACCCTGAATTGTGCCACCACCATGTTGA
AGATGAACATCCAGGATACTGCGACTACGAAGACCCCGAGTGTGGCCCGACAATGAGTTGGGGACCTCAAGCAGCCAGACCAAGTGGACACTGAAGCTCG
TGGAGTCGACGGCAGCCTGGATGGACAACCGACAGCTCGAATGGAACGCAACTACCCCGAATGGCGGATGATCATCCTGAATGGACGACGCCCGGAGTGC
CCAAGTGCCGATCATCCTGAATGGACCATGACTGCCCTGAATGGAGAAGCCCCAAGACACTGCAGATATCTGCCAATGGACCAACGCCCAGGAACGTGCC
AAGTCAGCGAAGTCAGCAACCAAGGTGCCAGTTCCGAGCGTGACTTGGTTTCACTATGGAGAGTGAGCCAGTCTGAGTTCGATGTGTCAGCAGTGCAGCA
GATCCCCAGGTCAGGCACCCGAGTCCCTCCGACATCAAGTGATGAGTGTGCGCCGCGACGCGACGCCTGGGTATACTGAAGCCAAGAGAACCCGAACAAG
TGTATGAGGATATGAGCAGAGGAGACCGCGTGAAGAATCCAGCGGCCCTCAAGGTAACAAGACCATATGAAGAAGAAGAGAAGTATACAACGAAGAAGAG
AGAGGTACAAAAGAGAAGAGAGATAGCCAAAGAGAGAGAGAGAGAAGAGGATAAAGATCAACAGAGTTTGTTTTGCGTTCAAGTGCACAAGTGCCTGGTT
CGTGATTCGCCTAAGGACAGCCGCCGCCCACGGGAGAGTGTACCATTCGGAGCCCCGCTGCGAGCGTTGAGTAATGCCTGGTCCAAGGCCCTCGAAAACT
TCTCACTACATCATCAAGCCAAGTCAGGTACCCAAAAGTATTGCCCTCTCGGGTCGATACACCTGTTTCATTTCCCAGTTGTGGCGTGCACTCTCAGTGT
GCGCTTGCATTTCATATTCCCTGTGTTTTAGGAGGTTGTGGCAATCGCCCCCTAGGACCCGATTGTAGATTGCGCGTGGTAGGAAGGTACCTGTATTGTT
CTCCTGACATTCAGGAGTGGTGCGCGTGGGGCATCCCGAATTTACCTGTATTCGGGGTGCAACCTAAAATTGACAGGCTGCATATTGTGTGTACAGACTC
TGTATTGATATTGGTTATTTTGGAGAAGGTTTTTTGCTCGTGATCTCACTCCCATTCAGGACTCCCGGAACGAGTAGCGCCCGGAAGTTCTCTGCATTCC
TGTATCTTTGATCAATTGCGATTCCCAAGGTTGAAACTCGGTCCGCCGAAGATAAACGACACCTATAGGGATTGCACAAGGTCACACGTCAACCGGAGCT
TATATTCATTGTGAGTTTCGGGTTTCCGTAAGCTAAACCCTCCCAGGTCTAAGCCTACCGGACGTACGCTATACACCCTGGACGATAAAGGCGTTCACCC
GCCTCGCCTCAGTGATGCCATTTCCGACATTGTAGACACCACTTCACCCCCCGGAACCGCTTACATTCGGTGCATGCGGTTGCGAGTTCGATTGGTGCCC
CATGGATTAGCGTAGTGTTATATCGAAGTGCGCTCCGGGCTGCTGCTTCTCCCAAAATGTTGCAGTTGTTGAGACCCTGAATGCCTTCTACTATCGTGGT
CGACCACAATATAATCCTATCCCGGCAATTGCGTCGGCGTGGAAGGTAGGTAGGTGTGACTGGAACGCACACTGCTTCAAACTCGTCAACAACAGTCCGG
TGCGTGCGTTCGTACCATATATCACTTCCTCGAGGTCTTTCGTACCACCATCGGATGGGTATCACAGTTCCAAGGTCATGGTGCCGAGGATCCCCAATTT
CACGATATCCGAGTTCGTGGGGGTCAACAACCTGTGTGCTGCGCTCGTGGTTTCGTTTTACTGCCACAATCCACTGACCCACACCGATGCGCATCTGATA
CGGGCGGGCACCTTCGTCCACTGGCTCCCACCCAACTGGGGCAACCAGAGTCATCGTCCCACCTATCGTTAATTCCGTTTTCCAGCACTCGTACAGGGCT
GAGATTGCTGCACAGCAGAAGGACGATAAGATGGTGAAACAATTCAAAGAGAATGGCGCCTACGGAGGAAATACGGTGGAGGAGCAGAATGGACTGGTGT
ACTTACCGGGAATGGACGGGCCACGGCGGGTAGTGCTGGCCGTCTCTCTACGAGCTAAGGCTCTCCGTGAAGCCCACAACTCCATCAACACAGGGCAGCT
GCGGACTCCACAGACTTTCGCACGAATCGTAAACGCGTACTTGTGGCCGGATACGCGCTCACAAGTGAGTCTGTGGGTGCATAGCTGTCGCGATTGTGGA
ACGCGCAAAACGCGACCGAAGGCGATCATCGCTCCTCGCAACTGCTCACCTCCGTTGGCCTCTTTCACCCCCTCCCAG