Description :
From Genome Similarity Track
Location :
Scaffold_2:28354- 30954
Transcript NameFunction/comments
Physo_127428reverse transcriptase

Sequence
2600 bases(100 bases per row)
CCAAATAATGTTTTTGGGTTAAAATGAGAACTGCTATTTTTGTTTTGTTTCTGACTTCCTCGAAATGTAATATTCTAAGATAGGAATCTGCCAACGGCTG
GTTGGCAGAATTCCAACGATATGCATGTCGCTCATTGGCTAAGAGATGCTGCTCTCAGCCAATAGGAATCCTAAGTCTCTATGGACCACCCGTCGTGGTG
GTCGTAAATGTATGTAGCCTTTGGTGTGTTTACACCAAGGTCGAGAAAGTCTTTCGAACCTCTAACAGACGTCGTGTCTGTTAGAGTTACAAGTGACTGT
AGCCACTTGTGCGTGTAACCCTGTTACACCATCCCCCCCTCAAGGTTAGACGCGCCGAGTCACGGCACGTCAATCAGGAAATTGACCATTCGTCAATTCT
TCACGTTGAGAGAAAGAAAACTCGAGCTCATTGCGGAATGAGCTCGCCGAAGAAGACCGCCGTCGAAACAGAGGGGAATACCTCCGCCGGGATAGAGACT
CTCTCTATACCCGAGTACCTCGAGCGTCACAAAGCAAAGCATGACGCTCTTGCTGCCAAGGCTGCGGCGGGGACAACTCAACCGGAGATTGTCCTCGAAG
GTTCATCTGTAGTCAACGACGCTGTTGACTACGGGGACGGCGACGTGGAGATGGAAGAGGGCGAGGCCTCTTGTAGCAAGCGCAAGGAGTCTATCGACAG
CGATAGTCTCGACCCGCATGCCGGGTCGAGACGCCCTCGTGAAGGAGACGACTCGGACGCTTCGAGCTCGAAGCGTTCGCGCGGCGAGAGCGACACTCCG
CTCTCTGCTGCTGGGGCCTTAAGCTCCCCGCGTGAGGTGGCACCTTCAAGCTCTCCGCGCGCTGCTCAGGCAGCGCGCGATCCGTGGATGCCGTCTGCGT
CAGAGATCGCAGACCGTGTTGGAAACACTGTGCCTCCAAACGAAATCCCGCTGTACGTATGCAGCGGGATCCACGGCGATGCTGTGGCGGAGGAGCAGCA
CTTTGATCCGTTAACGAATCAAAGGCGCGATTACTATATCGGACTCTTTCACGAGCTCCGATACTTCTCCAGCAAGAAGACCTATTCTCGCAGCAAAGTG
CCTGAGTGGCAGGCACTTTGTCAAAGTTGGAATGCTTTTGTTGAGAACTTCAACAAGAAGCCGGCTGCTTACCGTGAGCGGGTAAAGCACGCCCGTGAAC
GCTTCGAGACATTCTCGACGCGCGGGAGGTTGGAGCAGCTCCACAGATCTTCTGTGGACGCTGGTATTCCATGCGCTGTGCCCGAAGGCCAACAGTGCAC
GTTATGTCTTCCGGGTGCGGCGCGCTTGAGCGACCGCGACCTAAACGGGTACACGACGATTCGTGTACCTGCGAGTCTCAAGGATCTCCGTGCCAAGTTC
TTGGCACGTGAGGAACGCGACGATCGTGGGACTTCGGGCGCTGTAGGTGACCACAGCGCTCGCACTACCTTCGCGTCGGCAGTACGTGGTGAGCTTCATA
CGCCCTCACCATTTCCGGAACGTCCTGCAGCAGGACGTCCGGTGGCTCCCATGTATCTTGGTGGGGCGGAAACTTTCTCTAACGAATACGATAACGAACC
GGCTGCCGGTTCGTTTTCGGGATACTATGGTTCACAATACGCTCAATAATCCAGCGTGTTGAGCCGCGGGCGTCGCGGATCGGAGGCGGTGGTGGTGGGA
ACACGCCCCGGGTATGGTCAACCTGTGGTTGACCTTGGTCCGACGCTCGAGAAGCGTGTCGCTGCTGTGGAACAGCATCTGAGCCGGGAGTTCGCCGCTC
TGAAGCAGGAGGTGGCGATCCTGAGGGCTCAAGTCGCTCAGGGTTCGCAGACCGCATCGGGCATCCATCTCTGTCGACGTGGGAGGTCGCGTCGCACGCT
TGGTCCAGCGCGTGAACGCGCTGGAGCAGAGGTTCGCTCCCGCTGGGGCTTCCGCTTCGGGCCAGCCGAGCTAGGTGGCTCGTGCTGCAGGTATGGCTTC
AGCCGCCCGACGTAAAAGGTCGGATGGAGGCGCATGCTAGATGGAATGTCTAGCGTGTAGGCGTTGCCATGTCGTGCCAACACAGGGAACGGTCCGATGA
AGCGCGGAGCGAGCTTGCTCGCCCCGAAGTCGGAAACTGCATGTTTAGGCAGGTTTTGAGTAGCTAACAAAACCAATGAACCCTTCTTGAATTCATTAGT
GTTGCCCCTACCAACATTGTCTGCGTTCAGCTTCTGTCGGTCGACAGAAGCTGCAATAGTGTCTTGGACAAACCGAATGACGGCTTGTCTGCGCTGTAGG
AAGTTGATTGCGTCCGAGCTGAACTCGTTCAGCTCGTTTCTAGCAGTAGGCCCGGCCTCTACTTTCGTCTTCGCGGTGTCTGTGGGCTGCACAGACCCGT
TCTTCTTCTTCTTCTTCTTGCTCTTGTCGGCGTCTGTGTCCTGCACAGACGCGTGTTTCTTCTTTTTGCGCGTAGTCGCGGCTGACACTGTGCAAGTGTC
AGCGGCATTCTGCGGCTGCTGCGGTGCAGTCGGAGATCCTCCCCCACTTAAGGAAGGAGCCACCATCCCGAGTAGACTCGGGAGGCGTGGGTGCCTCATG