Description :
From Genome Similarity Track
Location :
Scaffold_65:283538- 285314
Sequence
1776 bases(100 bases per row)
AGCTGAAAGCATGAACCGGACGATAATGGAGTGGACAAGATATGGCGGGCAAAAGCAATTAATACGGCGGTTCTAGTGACAAACCGGCTCCATGTACCAG
TCACCAGACCAAGACTCCATATGACGTGATCAACGGGCGAAAATCAGGTTTATCGATGATGTCTATTTTCGGTGCGACGGGCTACGCACATGTCGACAAA
TCAAAAAGGACCAAGCTGAACAAGAAGGCGCATCACTACATGTTTTTTGGGCTACTCCGATAAGATAAAATTATTTTGCATGGTATCTAGATGACAAGAT
TTTGATGCTCACAAGATCGGCAACATTTGATAAGCGACCACCATCTCAGTTTGTTCAAGTGCATACTAGATCAAGTCATCAGAAGTTTTGCTAGAGACAT
GGAAGAAAGTTGTCACATTTCTTGATTAAGGAACAACAAGTAGGAATCGACTACATGGAGGTGGGCGATGACAGAAGGCGGCAAGATATTAACATTCAAG
ATGAGAAGATGGCACTAGGAGGTCGACCATCAAGAAGTGGCATTGCAACGAATATACACGTCAGGTCATACGAATCATCCTCACTATTCGAATTTGATGA
TGTGACGATGACTGAAGATGATCAAGTGGTGAACGAAGGGTTTTCAGCAACAGTTCAGTTGTTAACCAACATGAAGTCGACATCTCAATCTATATGCAAC
ATCTCAGGAGACGACAATATTTCCATTTGAATCCACACCGAGTTATTCATCTTAAGAATTAGTACCAGTGGGTAGATCAAGTGAAGGCTTACATTGCGGT
GGTAAAAAGAGCCAAGAACGGGGCAAAAAGCGACTGCATATTGAATATGAACATGCATGCACATCATATAAATCTCCAATGACATACGATGAAGTTCATA
AGTCACGCAAGGCGATGAGTGGAACAAGGCTATTCAAGCTGAGATGAAGACATTACAAGAAAAGAATACGTGGACGGATCAAGCTCATCGTCCAGGACAA
AATGTGATCAGGACCAAGTAAGTTTTCGCGATTATACGAAACGAAACTGGTAAAACTGAGCTTTAATATCACTTGGTTACCGGCAGACGTACGGCGTGAA
TTAGACATAGACATATTCATCGTTGGCAAACTTCAATTCGATTGGAATGTTTTTGGCGGTGTTTTCATAAAGGGATGCTTATTCATCATTATGACATCGA
CACTGCATTCCTGAATGGAGTCGCGGAAGAAGAGGTATACGTATACTATCCCCTCCGAGTACAAGCAGGGCGTGATCAAGTCCTACATTTGAACTGCAGC
TTATATGGATTGAAGCAAGAGGCAGTGACATATTTCAAACTTTTATAAGTGCTTCGTGGATATGGGATTTACATTATGTGTGTCAGACTCATGTATATTT
GTCAAACATACCGAAGAATCATGCATACACGTCGCCTTGTATGTGGAAGATCTTCTGATCGGAGCAGACTAAATAAGCGCGATAAATGAGGTGGCAAGTC
AACTCTCAAGTCGTTTCGAGATGAAGATCTTTGAAAGTTTTTGTTACATTATTGGTACTATTGAAATCTAGTACCAGCGAGATGAGCGACGAATAAAGAT
TGGTTAAGCATCATGCATATCAAGATTGGTCGAGACGTTTAATGAGGTTAACTCAAGACCAGTAACAAATCCAAGTGTTGAAGGTCAAACTATGATCAAG
ATAAACAAGACGGACCCAAGAATGAAGAATCGACCATATCGGTCATTGGTGGGGTCATTATTGTACGTGGCAACAG