Description :
From Genome Similarity Track
Location :
Scaffold_33:283534- 285422
Transcript NameFunction/comments
Phyci_221883Hypothetical protein

Sequence
1888 bases(100 bases per row)
CCATATTCACCAGCATACAGGATCGGTTAGTCGTTTTGCACTGCTGTAGTTGCTCGTTGTATATTACGCTCCATAAAATAATCATAAGGCGGCTGTTTTA
CTAGCGGCTTCCATCCCGTCTTTGGTATTTGCATCAGTAGCCTCATGGACCTGGCCTGATGCTATCCGGTCAACAGCACCAACTAAACNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGGCTTCCATCC
CGTCTTTGGTATTTGCATCAGTAGCCTCATGGACCTGGCCTGATGCTATCCGGTCAACAGCACCAACTAAACCAAGTGAATCATCGAACAACAGGATCGT
TTTTTTTTTTGCGGGGGGAGGGGGGATGTCATCAAGTCCCTAGAAGTCATCACGTTCATCATACACTTCGTCATCATTCCAATTCGTTCTTTCATCGCTC
TCTCCATCTGAAAATCTCAAGTAGCACACTTCTCATGGCTGGTACAAGTATCCCCGCTGCTTGAGTTTGCTACAGTATATAAAGTGACAGTACATACTAG
TTAAGTTAGTCCTGTCCGTTTATAATGTAATGTATATACACATTTGGTAAACCCTGGACTTCGATTGACAAATCTTCCTTCATTTCGTCGATGTCCTGAA
CCAGTGGTTGTTGTTCTCCAGCAACGGCTCCAGGTACTATAGTTCCGTCGCGTTTGAGGAGAGATAACTATAAGATAGCCAGACATAAGAAATCAGGTTA
GTATGTGATAAGCCAATATCAAACGTTGAATGTCAAGcgctcgtgattaacaccacccaagatcgggtccgcggagataccccattctatctggtacatg
ggtgggatccacgatcgacccttgaagagactacaccgctagctagcacgaggacccaagatcgggacccgcgacagcggtggtatcatatccataagca
ttacaacaaggctaggaatcaagtgaaCACCCGACTGAGTGAACGGATAGCGACCGACTGGTGCAATGGTGAAGTCTGATCGCATCCGATAGAGACTGGA
TTCCAGtcgactcgtccttcatgttcaccagcatttctccggttcttttgaataacgccgtacgggatgtcagggcagcaagcccagtcagttttttttt
tcattttgtagtgaatttgttgccgttggtcactgagccgtgcacacagcggaaccacaggtgcacacgtgtggatttatcagaatcgcgtgaagaaagg
ttacgctcggaagctaggtcccctgtggcTTTAtgtagtgggtctaacttgactcactactttagcttacacgttgcgcaacgtgtatgaggaagcgtaa
gtacttagtaattacttaggttaattatatttgaatacacaaatataattttaatcagataagactccaagtcgctagtttatggtaaaatgagaacagt
attgtttgtaaattgatcttcctcctaaaactgctaaaactgtttatcatctatgaaaggggttggtagcggctggctgtcagagccccgctaatataca
tgtctctgattggtagaaatacgctgctttctaccaataggatctttgggtaggtgtggaccactcattgtagtggcccacttcaatgtatccattggtg
tggcatacaccaaggtgaggaagtatctaaaattttaacagatatcctatctgttaaattcacaagtggcttgtagccacttgtacgtgtaaccccgtta
cacttgacccccttcgtgtcacggagtgtattaacggatacacgttagaaatgcaggccaatgggtcggattaccgtttgtttccgat