Description :
From Genome Similarity Track
Location :
Scaffold_134:28351- 30759
Sequence
2408 bases(100 bases per row)
AGTATGCAGACGTGTTCCCGGATAAGATACCGGCTGAACTTCCTGCTGACCGTGGGGTTCTGCACGAGATTGATCTCGTGCCAGGTTCGAAGTATTGTGT
GACACGGCAGTGGCCGTTACCTCGACATCAAGTCGAGGCTATTGACTCATTCTTCGAAGGACGCCGTAAGGCAGGTCAAGTGCATGAGAGTATCTCATCA
CACTCGAGTCCAAACTTCTGCGTGGAGAAGGCTACGGGAGGCTGGCGAAAATAGTGCATGCGTTTAACAAACTAAATGATGCCACTATTCGTGCGCAAAC
GCCTATCCCCAGGAAGGACATGGTGTTAAACGCCATGTCATATTTAGCGCCATCGATCTAACTGATGGCTTTTACCAGATCCTGATGAGAGAGAGCAACA
TACCACTCACAGCAGTTAGCACCCCGAGTGGCATGCTATGGGAATGGCTAGTAATGCCACAAGGGTTGAAGAATGCCTCGCCACTTTAAATCGCAATGGT
GTCTCAGGTGCTGAGACCATTACGGGACTTTTTTCCCAGTTACTTCGACAATATCTTCGTCCACAGTCGCGCTGAGGGCGACCTCAGCGAGGTCCAGGTT
CATCTTCAGCACTTGAAAAGAGTAGTCCAAGTCATGCGAGAGAACAAGCTCTATGCGAATCTCAAGAAGTGTGTCTTCTGCGCACCGGAAATTCCGGTGC
TGGGTTGCTATGTGAGTAAATCAGGCGTTCGAGCTGATCCAGAGAAATTTTCGTCCATCTGTTCTCAAGAACCCCACGGAATTACGTCAGTGGCTTGGCT
TGGCTAATTACTTGCATAAGTATACAAAGGACTACGCCGGTTATATACAGCCTTTATCGTCACTTTTGAAGAAAGAAGCCACGTGGTCGTGGCGTCCTGA
ACATCAAGCAGCCTTCGACGCAGTGAAGAAGAGCCTGGCGTTAGCGCCAGTGCTGGTCCTACCGGACGACTCCAAGCCATTTCACGTCGTATGCGATGCA
AGTAATTTCGCGATTGGTTGTGCCCTCATGCAGTTTGATCATGAGGGCCGTGAACGAGTCGTGAGCTATAACTCACGACAAATGAAGCCAGCGGAAAAGA
AATATCGATTTCACGACAAGGAGTTGTTAGCGATGCGCTACGCACTCATCAAGTTCCGCGTTCACCTACTCGGTGAACACACGTTTGCTTTGTACACTGA
TCACGCATCGCTGCGCACAGCGATGAAGAGTCCGCACCTATCCCAGCGAATGGCACGGTGGCTTTCGATTTTCTCCGAGTATAATTTCGTCGTGCATTAC
AAGCCGGGCAAGAACAACATTCTTGCCGACGCTTTGTCGAGACGTCCCGATTATGATACTCGGGCGGCGTTGAGTCATCAGGCGACTGACGACAAAGAAG
ATGATGATCGTTGCACAATGTGTGTGTCGCTGAAATTAACTCGGGTCAGTCCCGAGCTGTGCTTATTCGACGAAATCGTCGCGGCTTACGCGAATGATCC
AGACTACGCCGATATAATCGCTTATCTGCGCGCACCCAGTGACGTTGCACTGGGTGCTCTTTCGAGAACCAGTCGTGATCATATTCTGCGATATAGTTTG
GACGGGGACCTACTCCTGTACAGCATCGATCAATTCGATGCCCCTCGTACGGTGATTGCAACGACATGGATTTTCGCGCTCGAATTATTAATGAGTACCA
TGATGCTCCAACTGGTGGTCATCACGGCCGCGAAAAGACTTTCGCGGCTGTGTATCGCGACTTCTTCTGGCCCCACATGTACACGTGGGTGCGCAGCTGG
ATTCGTACGTGTGAAATCTGTCAAAGAGTGAAGCCATCTCCATCGTCGCAGGCTCTCCTGCGACCGTTTCCAATAGCAACTGAGGCTTGACGCCCAGTTT
CCATGGATTTTATCTTCGGGCTCGCACCCGATAGTCAAGGCAGAACGGGTATTCTGGTATTCGTGGACAGATTTAGCAAGATGACACATCTGGTTCCTGT
TTATGCTACGATCACCGCGGCAGAAACCGCGGTGTATTTCATCGACGCTGTGTTTCGCAATCATGGATTGCTGGAGAATATTGCTTCGGATCACGATCCT
CGATTCACATCCGCGTTCTGGACGTCACTGTTCGAGCTTCTCGGTACGAAAGTACGTATGTCAACAGCGGCCAATCCGGAAACGGACGGGCAAACCGAGC
GAGTAAACCGAGTACTCGAAGATGTCCTTCGAAGTTACGCTATGTCCTTAACGAGTTAGAGTGCGTTCCTACCACTTGCTAAGTTTTCGCTTAGTAATGC
TGTACACGCGTCAACAGGGTTGACGCCATTTTTTGTGAACTCGGCTCGACATCCCTACTCGCCGTGGGTCGCCCCACGGCTCCTCGTGACTCCACTTTGG
GGGGGGGG