Description :
From Genome Similarity Track
Location :
Scaffold_233:28350- 30172
Sequence
1822 bases(100 bases per row)
ACCTGACTTCGAGCCTGATCGTAGTGCCTCTGGATCCGATAACGCCACCGTCGAGGATTCCAATCCCGAGTCCGAGTACTACCCAAAGGTATCGTCGCGT
CGAGCGTCGATCGAGGATCCCAACTATGCACCAGATAGAAAGGGGAGTCTCCACGGACTCGGTCTTGAGCCGTGTTGATCGCGAAGGTCAATCGCTCTGC
GTACTCATCCCAATCTCTCTGATCCAGATCCTGCACGAACATCTTCAGGGCTCTCGTCGCCGTCTGTACCATTCGCTCTGCAGTACCGTTAGCTTGAGGT
CGATATGCCATCGTCGCTCGCTGACGCATACCCAGGATCTTGTTAAAGGCTCGGCCATTAATCCCGGTTCGCGATCATGCCTGATCACCTCGCTAGCCCC
AAATCGCCGGAACACGCACTCTTTGTAAGACTCGGCGATCGTCTGCGCCTTCCGGGACGAACTGGCCTTCGCGATCACGTATCCCGTAAACAGATCGACC
CAGATCAAGAGTTCCGTATTACTCTTGTACGACCTGGGTAGCGAAGGTATATGATCCATTGCTATGATCTGGAACGGGTATGTCGCCTGGATGTTTCCCG
GCGACTCGCCCCTGATCGTGGGTCGTCCTTTGCCGGTCTCGCAGTCGACACATTCGCCGACGTACTTCTGCACACTTTTGAAGAGACCTCTCCAGTGAAA
GTGATCGCGGATCCGCTGGTATGTACGCCCGATCCCCTGGTGTCCACTTTCCAGAGTGGAGTGATAGTGATGCAGGATATCTTGATGTAGCGTCTTCAGT
GCCACCAGTCTCATCAGTCCATCTCGATCTGCCTCCGATCGCTTGGAGGGTGGGCAATCGAACAGCAGATTATCACCGTCGATCTCATAATCCGCTGCGA
TGTTGCCATAGGATCGAGCCTCATCCTGCGTCAGTTCAGCCACATCTCCCATCAGGTACTTCTTCATACCCGCGATCCACGTTTCTTCATCCTGTGCTCG
ACGAATCCGATCGATCCGCAACCCTCGCACGAACTCCTCCTGCATGACGGTCGGGTTCGGCCGTGATCTGGCGCCCGATCGGGTGGTCATCGGCGATAGT
CGGGCGATCGACTCATCCGATCGGACGACCAGGATCTCATCAAGTCGGTTCAGGTCACTAGATCCCTATGATCGGCATCATCCTCGACGACGACGCCCCC
TTCAACGTTGGAGTGCTGCACTGGCCAGGCTGTCCGCACTTCCGTTCCAGTCTCGTTTCACATGAAACATTTCGTGATCTGGCCAGTTCCGTAGTTGATC
CAGCACCTTCTGCTTCAACAATGTCAGCTTAGGTACTTTGCAGTCGATTTCGCCCCGTACTTGCCGGATCACCAGGTTGGAGTCACCGCAGACCACTAAC
CTGCCTCGATCTATGCCGTCCAGGAGGTCGAAACCCAACAACAGACCATGATACTCCGCCTCGTTAACAGTCAGCCCTTCGGCATAGCCCGATCGAGCCT
TCACCACACTCCATTCGGGTAACTTCCACAAGATTGCACTGTACGCGCCCCCGCCTCGCTTGACGCGGGCGGATCCATCGAAACTCATCACCAGCAGCTC
TTCGTCCGCACGCACCGTCGGGATCGGGGCCTGAATCTTCCGCCGGGGTTCTTTCTTCGGCGCGATCGCGATCAACGCGTCGTCCATATCCGATCGAGGC
GTAGTACTAGTGGCGATCGCCCCCAATATCTCGTCCTCTCCCTTGGTGCACTTCGTGATCTCCAGTGTCCAGGGTGATAGGAGTGCAGCCCACTGACCCA
ATCGACCTTGAAGACCGGGTGA