Description :
From Genome Similarity Track
Location :
Scaffold_899:2835- 4553
Sequence
1718 bases(100 bases per row)
TCTTGTTTCACCCAGTGCCGTCAACATGGGTGTGAACAGCAACACTGGCGCAGTGCAGCCACGTCGGTCGAAACGCATAGCCAACCGAGCCATAACTGTA
GCCCTTAGTGCGGCGGATGCAACACTTCGCGAAATTATTCAAGAGCCTATCAATTTACAGGAAGCACGTGCGTCCAAGGAATGGCATCTTCGGGGGAAAG
ACATCAGAGATGAAATAGCATCACAGCGCGCAAACGTCATTTTAATTGATTGATGCACCTCCTGGCGCCAACATTATCAGTTCTATGATCGTTTTTCGAA
TGAAATTGAGCGGCAACGGAGAAATTGACCGCCTAAAAGCACGGATTTGCGCTCAAGGTTTCACTCAAGAGTTTTTAAAGGACTTTTTCGGGACCTCCCG
TGGCTCGTTTAAACTCCATCCTAGTCTTCTTTGCGATTGTAACCCAAAAGGGTATACGGGTGAGCCAAAGCGATGTACCGACGGCGTACATGAAGGCAAG
GCTGACCGAGATCACGTGTGTGAGGCAGCCGCGTGGATTTGAGGAGGGCAGTCGATCCAAAGTTTGGCGACTCAATAAAGCGTTATACGGCCTAAAGCAA
GTCTGTCACGAGTGGGATGTGGAGCTAGATCGGTTCCTCAAGGCATTTGGCTTGATCCCAACTCGTACAGATCGCTGTGTATACACTCACCCTCCTAACA
GTTTGATCGTACTGATTTATGTATATGATATCCTCATAGGATACCAAGACGAACGCGACATAAATCTTCTTATGCAAGCACTTCACGCCATGTACGAAGT
AAAGGGTCTCAGAGAAGCCAACTGGTTCCTTGGGATTCGCATCAAGATGGACTCTACTCGCGGAATCACAACATTGGACCAGTCACAATTCGCAACGGAA
GTTACCAAGCGTGTTGGTATAATCGATTGTCGTCCACGAAAAACTCCTCTCGGCAACGCTACCATTCTCTATTGGCGACcagatgacgaagaaagcGCCG
GAGACGCACCGCACCGTTAAACAGTTGACGCTTTACTCTATTTGGCATGAGTTACACGGCCAGACATCTCCTTCGCTGCCAACCAAGTTGCGACTCAGGC
ATCCAATCCATCTAGGCTGCATTGGATTGCAGTCAAGAGCATCCTATGATACGTTGATGCAAACAAAAACATGGGATTGATCTTTCAACGCGATTTATCT
GCGGTTCCAGTTCGCGTTTACACAGATGCTGATTGGGCTAACAATGAAGAGGACAAACGCTCGACCTCAGACGTGCTGGTACACGTTTTTGGATGTCCAG
TGTCTTGGTAAACTAAATGCCAGAAATTTGTCTTCAATTCATCCACCATCGCAGAAcatattgctgctgacgatgGAGTAGACGATGCCCAACTTTTACT
ATAACAtttgttgaagttgcacgAAACTGCAGCTATTCCAGCAATAATGGACAACACGCCGACCATCAATCGACAGACGAACGGCAAGAGCTCGGAGGCT
CAAAAGACAGTCGATTTCCAGTTTTTCTCTATTCGGGATGCTGTTACAGCCGGCCTTCTGTAGTTAATGTACTACTCCATAGCAAACATGCTAGTGGATG
GTCTAGCTAAAACACTCAGAACGACGTGAATTGAGAAAGGTAATTGATGTCGAGGAGCTATCATCCAGCGCTGACGGGGAAGTGTCGGCGAGTCGGCCTG
GCTTGTAGTCACTAAGAT