Description :
From Genome Similarity Track
Location :
Scaffold_90:2835- 15472
Transcript NameFunction/comments
Phypl_g2854conserved hypothetical protein
Phypl_g2855conserved hypothetical protein
Phypl_g2856hypothetical protein

Sequence
12637 bases(100 bases per row)
ACGTGCCGGCCTTCTGCCGGTGTGGGTACCATCAATATGAAACTTATGTTTTCACCAAGACAAACTGACCCCTTAACTGTCCTTGTGATTATTATCGTAA
ATGCTTATTGGTTTAGCCTTAGACAGCACGCGGCGGATCAACTACTGTATCGTTAGCTAGCTAACAGATCGAGATTGGTAATTTGTATACCTTGGAAAAG
GTAAATGCATTATTCTGCTTAGAACGTCAACAGTTCTTCGTGTTCCTTTCTGCGAGAAACAACCGAGTACTACTTTGATATGCAACGCCATCAACGCTGA
CCTTGTCGCAGCAATACGTGAAAATCCCCACCTCCATCTCTCTCGCTCTTCACTTCTTCGCAGCTCCGTCCAACTAGGAGCTTCCTACTGGCTGGGATAC
TTTTCACCAAGCCAGGCAACCACAGCGATTTTATCTTGGAATCCACCAAGCATGTGCTGAGTTCTCGCGGCCAGCTGCGGACTTAACGCGTTAGAGAGCT
TCTCGTGCAGGAAAAGAAGCACCTCGAACAGATTCGCCGTCTGCAACGATATATTCGCGGTCGATGGGGTAAACTCGGGAAAATGAGTGTGCAACCAATT
TATGACAGACACATGCCCGAACATGACAGCATATTCAATCGGGTTGGCAGTGCACCCTTCCGATCGGTTCGCGTCCAGAAAATGCTTCAATGAAATGCTT
CAATGGCAGCCATTGAAGTATTTCTAACCGACCACTACCGGCGGCCGTATCGACGATATCCTTAGATCGTGCCCACCACGCCGTGACTTGGTCCGCTTGA
TTCTGTTCGCTGCAATTGGTCCTTGCCAATGGCATCTTGCAGCTATGCCGACAATGTAGTCAGCTGGGCGACCTTGGTCAGGGAATCGGACATGCTCCAC
CAGCCACTTCGTCACATCAAAGAGTCCATCGCGAACAGCTCGGACCAGAATATCCCCATACTCTTTGACAGTCTCTGGATCGGAGACCTCATGAACAGCC
CCAATCTCGTATACGTACTGCATCACCTCAACATGGCCACACTCGCCTGCGATGCACACAAGATCAGAAAAATTCTGTTGCTGCCTCATGTGCTCGCAGA
GGGTTTGACCCAGTGGGTGATCCACTAGCCATCGCAGCATCTCGAGATATCCCTCCTCACAAGCGCTTCGAATTGCAGCGTTCCACGCACGTAGGCACAG
CGTTCGATTCTCGGCAGCTGGTGAATGCAGCaacgccacctgctgcatgAGATCCAAGCGACCTTTTCCAGCCAAAATCTGAacagcagcgctcgcacaT
CCTTGATCGCGTCGAATGTAGCCGCAATCGAGCATGAGTTCAACTAGGTCCAGTCGCCAGCACACGCCCAATGTCTCTCTCCGCCTATTCTCCCGGAAGA
TTATCCCGGAGCCACTGCGCAATGTGCGCGTGCTTGTAGCCCTCGGCATACTCCATGACCGAACTCCCCCAATGGGCTGTAGTGGCCCCATAAGCACCAG
ATTTGATGTCCACCTTCCTCCTCTTAACACTTTTAACTCCCTCTTTCTTGTGATGTCCAGGGTCATGAGCCCATAGGAACTGGAGCATGGCCAAGTTGCC
GAGCCTAGCAGCGGCCGCGGGGGCCTCCAGAGGCCCTTCACAGCCCGAGAACCGAGTGTACAACCACTtgaccagctccaggtcgctTCGATCCGCTGCA
ACTTTCATCGACTGGGCGAATTGGTAGCGATTATAGTGCGGATCCGAGCGTAAATAATTGACGAGGGACCATCCTGGCGTTCGGTCggtggtggaagtgc
agCTGGAGTCCCAGATCCATTCCAGAAGCTTCATCGAGTCGAATGAGAAGGCCTGGCCTAGTGACAGGCTGGGGGCGGGGCCGAGGAAGCTAGAGATGGT
CGCCGCTACTTGCTGTAGAGCACCTGAGCCTGGCTGGTGTcgcagcacgaaggtgaCGGATTCCAACGGACTCGACGGCATCTGACTCGTGCTCGTTTGT
CACAATTCTTGGACTTCGGATACACAAAAAATTAAAACGTGCTACTTTTTTAAAAGTAAACACGTTGCTCTTTTAAAAAGAGCAACTTGTCTGAAGACAC
ATGACTCGTTGACATGGATGAACCATCAGAAGGCTGTGTTAGTTGTCAGCTAGCCAGGCACTGACGCCGCGATTGATATTATACTGGCGAACATCCACTT
TGAACTCTGGCGTGATCACTTGGGGGAAGTGGACATGTAAGTAGAGAAGCACCTCGAACATGCTCTCCTTACCCACGCGTCGATCGATTGCCGTAGGAGC
GTGCTCGGGAAAGCGCTGATGCAACCAATCCAAAACAACTACGTGGCCTTCCTTCAAAGCATTTTTGATCGCCTGGACAGAACAGCCTTCGGATCTGTTC
GCGCTTAGCCATTTGATCACCTTCAAGTGACCATActgagcagcttcatcgatcgccttcttcgtgcaCCCCTCACTCCTGTTGAGGTGAAGCCACTTTA
CTGTCTCGAGATGGTCGTTTGCTGCCGCTCCGTTCATAGCAGCTGTACTGCACCCCTCGGTTCTGTTGGCATGGAGCCACTTTACCATTTCCAAGTGACC
TCTGGATGCAGAATCATCCATCGCCTTCTCGGTACATCCTTCAGATCTGTTGGCATGGAGCCACTGGACCAGTTCCAAGTGACCGCAGCATGCCGCCTGG
TCCATTGCATCCTCGGTTACCTTTTGGGGTGAGTAGCAAGCAGCCATTTGAATATATCTACCCGCCTACTCCCACCAGCAAAGCTCATCACAGAGCGAGA
TTGAGGCCACTACGCAGCAACCTGATCACCCCGGTTCTCCTCGTTTTCAGATAGATCAATCACTCCAGACGAACCGAGTTCGTGGAAAAGCTTCAGAATA
TTGAAACGCCGACTTCTCGTGGTGATATCAATGGCCCTGGCACCAGGCAGGCCGCGCTCAGGAAACGGAatgttcttggccatccATTTCACAGCATTGT
AACGATCATCGCGGATTGCTATCATGAATTCTCGTGCGTACCCCGTAATCACAGCTTCGTCCACACCGCCTTGTTCGTAAAGATACTGAATGATTTCGGC
CTGATCATTCTGGGCAGCCAAACACACGAAGAACGAGTACTTCCGATTCGGCTTCATATTTTGTCGAAGTTCCTGGCCCAACGGGTGGTCGAACAGCCAT
TGCAGCATCGCTAAGTAGCCATTTTCACATCCAGTCCTAATGGCACCCGACCACACATGCAAGCACAAGGAGCTATCATCGCAACGTGGTGAATGAAGCA
GCACAACTTGCTGCATCATATCCAATCGCCCGAGATGAGCTAAGTCCTGAATAGCCGAGTTGGCCAGGCTTATATCCCGCTGAATATATCCGCAGTCCAG
CAACAATTCCACCATCTCCACACTTGAGCAAACCGCGTAGTCCAGCACGCATCTGCCCTTCGGCATCAGGATCTTGGCGATTGCATCGTCTCCATTTCTC
AGTGAATAGCGGATTTCTCGCTCAATGTCCCCCTCATTTTTTTGGTCCGGCATGTGTTCATGAAGCCACCGCACAACGTCTGCGTGCCCAGCATCCAGCG
CACTCATCATCACGTTCTCACCCCAGTGAACCACGTGGCCACCAACAGCTTGACTTGGCTCCAACTTTTCGGCCTTGACACCTTCACCACCTGTTCGCAC
TTTTCTCTTTTTGTTACTGTTGGTGTTCCATCCTTCTTGACCAGAATCATTCGCCAGTAGAAACTGCAGTATCGGCAGGCTGCCTGCTCTTGCCGCTGAT
ATGGCTACATCTACAGATATTTGACAGCCCGAGAAGTGAGCGAACAGCCACTTGACTATGGGCAAATCCCCACAGTGAACTGCAACTTCCATCGACTTGG
CAAACTGGTCGCGATTATAGTGCGGATCGAAGCGTATAAAGTTGTGGAGGGACCATTTCGCTGGTCGATTGGCTGCggacgtgcagctggagtCCCAGAT
CCAGTCCAGGAGCTTGGTGGAGCCGAATGCGCACGCTTGACTGAGTGCGAGGCACGATGGAGGGCTTAGGAAGCTGGAGATGCGCGTTGCTGCGTGCTGC
GGAGCGCCGGGGTCGCGCTGGTGCCGCAGCAGAACGGCGACTATGATCAACGGCATCGTTCTATACTTCAAAGGCTTTTTGACTTGGATATGTATGAAAT
GTGACGAGTCATCATGGAACGAGAGGTTTAAACCTGTTTAAATTGAGAAACCTACTTTAAACTGGTTAAAACGATTATGATTAATAACAGGTCTAAACGA
GAAGAAAAACACAGATTTTTTTAAATTGGGTTTGAGGTATTTAAAAACTAATTCGGGGCATCAAGCATTCATTAAGACTACGATTCAAAGGTAGTGTGCT
CTGAGAGCCAGCCCCATATTTGTCGGATTGGGATCGCGTTGAGCTCCATTGAAACAATACTTGGACAAGATGACTGCGACAATAGGGGTTATCACGGTTG
GAACGTATGTTTCGGCAGCCAATCAAATTAAATCTTCGTGTCCCGTCCTTTTCCTATCAAACCTTCCTAAAAAAACGGAAGGTATGAAACGGTCACGGTT
GAAAGGTGAAGGTTGGATTTGATTGGCTGCTGAAACATACTTTTTCCAACCGTGATAACCCCTAACCTTGGATTTGGAAATGAGTGGCTCCGCCCCAGTA
AAAAGTGAGTTGCGAAATTTGGAATCCACGATGTGAGCCATGTTTTGCCTCAATGCGTTGTCGACCATAGGAGTCGTGAAAAATCCAGTTCGCTGTGTGA
CCCAAACAATACACGTAATCTGGAAGCTTGGTGAATCCGTGCCGTGAGGGCTTGCGGAGTTGTAATGCTTGCTGGAGGACTAGGCTCGAACGTCAATCTT
GACGTATAGAGGTAACAAATGTTTTAGTTACTACACACGTGTGTGAGATGACAGACTGTCGTTCAGTCGCCATTTTGGTGGAGCTAGCACATATTTAGAA
GTGATTGCTGTCGTAGCAACTGGAGCTCTTCTTTATTGCATCTGGCGCTTGTACGCCATAAAGTCAAATACATTTTTCCAGGATGAAAATGATGATCTCG
GCAACATTCGTGAGCGCTGCATCCTATTCGTAGGACGTTGATGCTGACCATTATGTCTCGTGGTGACTAGCTCACACATGCGCAACATCATGTCTCCATA
GTACAGGCCCCCGAAACTGTTCGTGCCTCGTGGACACCTTTGAGATGAACGGCCCACACAGCCTTGGTAGTGTCCTTGGGAAGGACTCTAATTTTCCAAC
AAAAGAAAGGTGACATCTACGCCGACGGTGAATCGTGCAGAGCGAGACGATCAAACCGCTGGTTGGTCCTTAGTGAGGAGATCTTTTCAACGCACGAGAG
CCGACGCAGATATAAGGCAAGTCGGTCTAGGATTTGATTAGAGCAACACGTCTTAACCGTCCCAATCATGCCACGCAGTCGCTTCAACAACTCTCTGTCC
CAACTCGGCCCAGGTGTTTGTGATCCTGCTTCCCGAGGACGTCTACGGAACGGTCGCGTCCCCATTCTACGCCTCCGTCACGCGAGTGAAATGGGCTTTG
GTGGAGGCTCGGTGGAGTGGAGGTCTCTACGCGTACGCTGCAGAAAACCGTGACCGATGCTCGCCGCATCCCTTCTGAGGAAGCAGCGGGATACTACCGA
GGAACATGGCTTCGTCGGGCTGTCTGCTTCGAACACCGCGGCTCTGTGTGCTACGGCCAAGTGATCGCCTACGATGGCAATAAGCTCTCGATTTCCACAC
ACTTCAGGACCAAGATGGTGACATTCTAACGCGTACAGGAGGGGTCACCACTGTAACCGCTCTGGTGCTAGGGAGTCGGTGCTGGTCCAAGGCAACATGG
ACCGCAGACCATCTGCGTGATCTCCAAGACCAGATATTATCCCGCTTGATGGAGGGTGACGACGGTGCGCCGTGGTAAGGGAGTGGCTGCGTGAACTGGG
GGACCTCAGCGATCTACGTTACGACTGGGTAGATCCAaccaccggcagcagcatgagcaccTCCTTTCGCCACGTGGCCTGGTTTGCCTTTTTTCGTTGA
CGGCCACAGGAGCTTGCCTACCCACCTCTGCAATGCTCTCGAGTCATACTTCTGCGACGAGCTTACCATGGCGTCACCGGGACAGGACACAGCTGCCGCG
TCTGATTCAGGCTTCTTTGACGCGCTCGTTGTTGATAACAGTGACGATGACGGTGGCGCGACATGGCGAGAACGGAGCCGGCTTCGCGATATCCGCCATC
CAGGACCAGTGTGGACTACGACCATACGACCCCTCCTTGCTTCGAACAGGACGGCGCCAGTCGAACCCTGACGTACGGCCACTGGTACAGACTCTACCAT
TAGCTGCCTTAGAAATCGAGCACATTGATCTCATTCGGCAACTCAAGCCACACCTGCTCCCGCTCTATCTGAGTCAAGGCAGTGAACAAGGCATGCACCA
GCGTCTCCCGTATGATGCACGTACGTTCGACGCACCACCTTCACCAAAACGGGTGTGGGCATCGCTCGAGGACAGCCATAGCGCCCATGTTTCCCAGATT
TAAAAACTAATCAGATTTCTGATTATCCCTGTTTTCCCCATGTTTTTCTACAGGTATGTTCCAGGTATCCCAACAAAGAGTCGAATCAGACTGTAGTAAT
CTATTCTGAACGCGTATATTACGCGACCGGATATTGTCCAGTTGGGGATACCTGTAGAAATTATGTGTGCGGGACCAGGGAAGAAGCGAAAGTGACAGCG
CTGAGGGCTGTGTCGGAACCCAGTCATCCAATCCGTACGCTGAACTTCGAACCAGGTATATACAGGGACAAGTACCTGGAAAAGTCATGTGTGCACCAAA
TAGCACACAAAAAACGAAGCGATTGTGCTGCGTCGGGCAACTGTTCTTAGCTGCACCTGCAACATGGCTTCGTGAGGATTCATGCACGATGTACAGGTTT
TTCCAGAATGTATCCAGGTATTGTCCATGTATTGAAAACAATGTTAGCCTTAACCAGCCTGCAGGTCATCTTCGAACCAACTAacgctgcttcatcttca
aaATCGCGTGCAGCATCGTCCAACGCAGCTTTGTTAGTCCAGATGTCGACAGATCAGTTGGGCCTTCGTCGCTCACACAACTCCAAAAGAAACGACACAC
AAAAGCACCACAATTGTCGCTGCCTTTCTGTGTCGGCTCCATCACATCCAGCTCCGAGTACATATTGCCTTTTAGTTCCTTGCTCATGAGTTCTCCAGCC
AACGCTTTCAACCGTTTTCTGTTTTTCTTGCCATTCATGCTGTCGTATATTTTCACCTTTTTGGCAGCCCGATCGACTATAATGCCGGCCCAGTGAGAAC
CTCCAATATTAATAGGCAATAATAAGAACGCACGCTTTTCAATGCCACGAGCAACTTCATCGAGCGTCTTTGCAGGTAAAACCCCGTTTTGATCATCTTC
CTTCTGGGTTTCCTTTTCTTTTTTTGGTGGAGGCGCTATCACAGTCAAATTATTCTTGCAACGCGCTAGGAACACAGTAACAACCCGCAGGGCATTGTCG
CTCAGCCAAGTACCGTCTTTGAAGCAAAATAGGTCTGAGTAAGTAAAGTCAAACCCGAATCCACGCAGTGACGCATACGGCCAGCACTCCAGTAGTTCCA
GAAACGCAACTTGCGGCAGGACTGGGTCCTCCACCGCGGCCTTGACAGTGCGACTAAGCCACGTACAGCTCAACACTGCGTCTCGACACGTCGCTTGGAG
ATTCGATAGCCACCTCATTGCATCTAGATGATCTCTTGTGAACTGCCCCACTTTCTCAATAGCCACAACGAAGCAAGTAATATCACCGTCACTATCAAGT
TCAATATCGTCTTCAATTGCAACACCTAAATTCAGCTTATCTAAGAGCAATACCACCCGTTCAGACTAAACTAAAAGTCAAATCAGCAGACCAGCCAATA
TATAAAGTTGTGGAGGGCGACTGTTCATTGGTGTTAAAAACGGTTCGTTTTGGGCAAATAAAAGCTATCGCTGCACCAAATATAGCAAGCATATAATCAG
CGACTATTCAGTTATCTTGACTTTTGTATGAGCGTTTGTTGATGTTTAGTCGGGGTTTGGTCGAACCCCTCAAATTTATATGTTCATTTAAGTCCGATGC
TTTACGTTTAGTTTAGTCGGAACGGGTGGTATTGCTCTAAGGCGCCATCGATAACAGATTCGGTGAGTCTAAAACGCACCCTGGTTGGCACGTATTCCTC
CTCAATGCTCCACTTTACTGCTCTTGTTTTGGTGTCCGACTTGACTTGAAACATTGCCAAGAATGATCCGACCTCGCGTACATGAGCCGCGATTTCACGA
AGACTTACCACGATATCGCATACGTCACTTTCGCGCAGAAGTGCCCTTAGTTTCATTCCCTGGTTGTATTCTTTGTGAGCCACccgcgccttctccttca
acGATGCGCGGTTGATAGTGGGCCGGCCTATGCGTTTGATACTGCCCGACAATTTCACCGTTGGCATGGAATATGGAGCTATGCGTTCATTTTCGGTACT
GTGATCAGGCCTGACCACCCGAGTATCATGCGATGCAACTTGTGTAGGAGGGTCATCATCATAttcatcgtcgtctccatTTCCAGGCGGATTGTCACCT
CCGCCAAGCTTCTGCGACGCATTTGATTCAGCACTATCCCCATCAGCACCTCCACCCCCCTCCTCATTTTCCGAGCATGtgacagcagcttgtccttcgt
cctcgtcttgACTTTCTTCATCACTGGAATCGTTCGCCTCTGCATCAGgagcgtcttcatcgccagTGGATTCATTCACCTCTGCGTCAGGTGCATAAGG
GCCGACCTGCTCGCCAGTATGGCGTGCGTGCGCACGCCTCCGAGCTTGCGCTTTCTACGACCGCGTGCGAGCACATGCAACAGCGCGCCGATGCTCTTCT
CTTTGgcgcgcctcctcctcctaGCGATCTTCTTCCGTCATCCGCGCCTTGATCCCTGCCGTCTTTAGAGTCCGCGCCATGGTGGGGTCTTGGGAGGACG
CTcaacgcccagcagcaagcgaccGTCGACTGTCGCGTGGCGCGCTACCCCAACTGGTGGCTGAGAGGCCAAAGGCAAAATGTCGGAAAGAAAGAAAAAA
CGAAAAAACGAAAATTGGTTTGAATTACACCTGGACAATACCTGCCTTAATACCTGGATAATACTTGTTGGGTAAAACCTGGTCGGGAAGGGTGCCGATC
GTTCAACCCACAAGCGACCAACAACACGTTCACGAGCTCTTCACGGCGGAGTACCTCCAAGGTAAGTCAAGTGATTTCTTCTATGACTATGTTTTGGCGG
CTCCGGTAGCGCAGATCGACACGCAACCCAGCGCGGTTGGTGTACGACTTGCGATTCGGGTGTGGGTTCTCAACTAAACACTTTCTTCGGTCAGTTTCCT
GAAGGAAATTGAAAACGGCGGAACTGACAGTCGTGATTTATAGCTTCAACACCAAACACCCCTGCACCAGCCTCTTGGGCCGAGCTGGGATCAAAGACAA
GAAGCTTTGATGACTACTGTCGAGCGATGTGCGAGCATAATGCTGGTGAATCACGGATATTTGTGCTGTGCTCTTAATGTAGGTGTTGTGATCTTCAATC
AGCTACTGATATTCACGTATAGAAGTAGGTCCACGCCAACTACATAGTCGCTAGGTGTattgccagcaccagcttttTCAGCCTCAGCAGTGGTGGCAGT
CCAAGTTATTTTGTTGTGCCCTGTTCGCCGTCGTGGCTATGTGCCTGGCGCTATTCGATacaaagctgcagcttcgacttgaGCGCAGAAGATCGCTGTT
AGCCCGTTGAtttcagcgtcttctgcagTGGACCTTGATTGTGCTGCAAACAAATCCGATCCTCTGGAACTCATCGTTTTTCACCCTTCTTTTTTATTTC
GTTTGCTGCTTCACAATGTTCGCTGCCATTTCGTACCCAGCATCAACCGACCAGATTCTCTGTACCCTGGTGGGTGGTCTCACTTGATTTGTGCATGTTA
TCTACTTGTATAAGGGCATACGAGCTCGAATAAGTGCTATAGCTGCAAGAAATTGCCCCGACAGCACGAATGTACAACGGATGAATTCCACTTTGGAAAT
TTTATACGCTTTTACTTTCTCGTCACAGCATACAATATGAAGGCGGAACAATACGGCGGACGCGGGTTCGAACCTACGGTTGGACTTTGCGAACGTCGTT
GGCCCTTGGTGCTGAGGGCGGGTTCGCGGAGGGGGCGCATCGTCACCAAACATGTCTTGTCGATGGCGTTTGATAATACACCACCCGGAAATTTAGTTTA
AGACGCCAACAGGGAGCGCGATAGCAAATGTTTCGCGCTAATACGCCGGCAGTGAGTACAAACCTCGTAACAGGCGGGAGCGCAAGTACCGGGCCATACA
CTTGCCATGATCTCGTAGGTGGCCTACGCAAAAGTCACGAAATAACTTGCGATCTCTAAGCTGCTGCATGTTTGGACAGAAGACGAATACGATCGAATGC
AAATATAATGTTGTCAGCCTCTGTCATAAGGTTTTTGTGGTTACTGTCGCCAGTGTTTTCATGGACACTGTCGCCGGATATTTCTTGGCCACGATCACCT
CATGATCACTGTCACCGGAGTTTTCTTGGTCACGGTCATCTTTTTTTGTCTGGTCGCTGCCACTGTTTTTTTAGGCCAATAATTTCTTGCTAATCTCTTA
AGGATAGACTCGCTAACGCAACAAAAAAAGTTTATCGATGTCCGATGGAGTTTTATCTTTCTCGGTTGGCATCCTACACTTACTTGGTTGCCATCCTACA
TGTCGTTATCGATGTCTATTTCTTCGCTGTCAAATTCGTCACATTCGTCGCAGTTGTCGTCATCCATCTGACTCTCCTCGCTCACCTCGTTTTCTTCACT
GTCTCCCACGTCCTCGTTTGCATTACTGGTGTCTATTGCTTCGCTCATCGTGCTCGCATCACCATCCTCGTTCTCTTGGCTGGCCTCAACATCCACTGTA
TCCTTGATGTCCTCTACCTCATAATCGTTCTCGTCATCAGTAGCGAGGACTATGCAACGAGCCCCTCCCATTCGAGCTTGCTGCTCACTTTTGTGACGGC
GGCCGATGTGCTTGGACATCGAGTTCTGGATGTATTAGGACAGTTCGCAATAGGGGTACAGGTACGCTCATTCCACCCTACAATTTGGTTTGTGCATCGC
TTAATGGCGAAAATATCCCTTCATGCATTTGACGCAACGAAAATCCTTGAAATTTTCAGCTTCCGTCGCGTTCGGACGTTGGTAAATTCCTTGAACAGGG
ACGTAGCAATGAAGGCGGACAGCCTGCACTTTGTATTTTGCTCCTGCTTGAGTCATGTCTTTCGAAACAGTAACATATCTCCTTGGGATAATTCCAGGGC
TAACCGCTTCCCTTTCTCAGGTTGGTCACCGATGCAGCGCGGGTACACATGAAATATAGGTTCGACCATTAAAGCAAGGATGACAGAGCCCTAAACTACA
TAGTGTCGGTAATATGCTTGTGATATTTTGAATGACGGGAAGTCCATGTTCACTGCATGTGTGCTGCCACCAGCCACCGATTTTAGGGTATGCCATGAAT
CCTTTCTCACTTCCCAGCACATCGTTCGCTGGATCCACACAGCGTACCATCACACCGTGACTTCATTGATGGCGGTATTATTGGCGATCACCAAATCTGC
TTGCCGGCGATATAAGGATTTTCATAGTACGCCTTTCTGAAAATTGGATGTAAATCCAGCCGCTCAATCTCAGATAAACTCGCTCATACAACCCTTCCGA
AACAGCCGCCTTCTATTCGACGAATCCAACATCCCCGCACTTAGCCAGCTTAGGCGCATGCCTAATGCCATGTTATTGCACACTTTTGGACTCCAAGAGC
AGCCTCCCGGTTACTACGAAGCTTTTCGTACGGTTTACACGCCCGTAAGGCTAGTTGGCGGTATCATAGATTGTGCACAAGCCGGTGCAAGCAACGACTG
CGTCTTCCCGAGGTTATTCGTCTTGTTCGAGGAAAGTCGCATCGGGATCCGTGCCCGAACAAGCCCTGAGTGTTTCGGACTGTCTTCCATGTTGGCGAAT
GTATCGATGCAAGAACGAGTGGGATGCCATTGTGACTCATGGAGTTAGTCCGACGTGGACGGTACCATTACCATCAGAGCCTCCCTACCCCTTAAACTGC
GGTTCTGGTCTAGAGCCTTCGGAAGGGCCAACATGGAGATCGCTATCTGATTTTGGATATGCACCTATCCGACTAGCTAGGCGGGATCACTTTGGGGCAG
TCCCGAAATGTGTTGCCGATACGTCGGTCGCTGCTAGAGTGATAGGTGACTCATCTTACCCAAAGGGCGCTTCCGTGAACGATTAAGCTCAATACAATTG
CGATATTGATGTAAATAGGATGGTACCGCAGTGCTAGCACGTCGCGCCCTTCAAGTCGAGTAATCTCATCCAGGACCTGCTCAAATGTCTACCGGAGACA
ATCAGGGTTTCCGCAATATCCCTGTCACAGCGGAGGA