Description :
From Genome Similarity Track
Location :
Scaffold_63:283461- 289768
Transcript NameFunction/comments
Physo_138446reverse transcriptase
Physo_109143reverse transcriptase

Sequence
6307 bases(100 bases per row)
CACTTCCTCGACCTTGGTGTAATGTACACCAATGGCTGCATACATTTACGACCACCACGACGGGTGGTCCATGCACATTTAGGATTCCTATTGGCTGAAA
GCAGCATCTTTTTGCTAATGAGTGACTTGATTGTTAGCAGAATCCTATCAACCAGCCGTTGGCAGATTCCTAGTTTAGAATATTACATTTAGAGGACGTC
AGAAACATAAAACAAAAATAGCAGTTTTCATCTTTTACCAAAACCCGCTACTTGGAGCCTTTATCTTGTTTAAAGTATACTCGTGGATCTCGAGTATACT
TAACTCAAGTAAAAGAAACCTATGCTTCCTCATACACGTGCGCATACGTGTAAGCCCTAGTAGTGAGCCAAGGTAGGCCCATTACACCTGGTAGCACTTT
GTAGTCCGTCCAACGACCGACTACCTGAACGTTCGTACGGAGCTGTACGTACGAGGACCGAGAACCTTTTCATGAGCGCGGAGGTGCACATGGAAAGCTC
CACTTCGCCTGCAACTCATGTTGCACGCGCTGACTGCCTCCTCCTGTCGGATCCAGAGTGGGAGGCACTCCAACGACTGTCAACAGTCATTGGGGAGGCG
GCAGTAGCTGCGATGCTGCGTACGCTATCGCCGACAGAGCAACATGGTGTTGCTCTGGGGTTCATCGTGAAGGAGCAGCGTGATGCTGCTTCCTCTACCA
CGGTGGCGTCGGAGACGACACCGCGTGGACAATCGTTGAAGCTAAACGTGAGCAACTATGTCGGAAGAGAGGGAGAGCCTCTCCTCCGTTGGCTTGTCGA
ACTCGACACTGCCATCGCGGCTCAACGTATCGTCGACCCGTTGTCCAAGGTTGCGTTCGCCATGACATGCCTTGGCGGACGAGCGAGAAGTTGGATGGGC
GCCGACTCTCTGATCCTACGTGCTTCAGCACGTACGAGGGTTTCAAGGAGGAGCTCAGGCAGCGTTTGAGCACCCGCAAAATGAGTTTCAGTCGAGGGCA
GAGTTCCTCGACCTGCAGCAGGGCAAGCATGATGTCCATGCTTACGTTCATGAAGGGTCTGAGAGATGGGCCTGTAAAGACCTATCTATTCCGTGAGTAC
CCGAGTACTCTCGAAGCTGCAATTACTCTTGTAATGCAGGAGGAGTTTAGCCTGCGACAGGCTAAGCTGCATGCGAATGCGCCGAGGCTGCGACCGCCTC
CGTTTGCGATAGCGGGAGGTCCGGAACCAATGAACCTCTCGAATGCAACGGCTGCTGATTATCAACAGCAACAAGGAAGTAATGTACGATGCTTTCGTTG
CGGAAGGATCAGTCACTATGCCCGAGAGTGCACGGCACCCGTGCACCGAGATGGTGGTCGACGCGGCGATGCCGGGCATCGTCGCGGACAAACAAAAACG
CTGGAACCCAGTAGGCGCGGGGCGCCCTACTGGTGAAGCAGTCACGAGTGTCCAACTCGGACATGCGACACTGAGGACTGCAGCCCCCAGTGAGGACCCT
TCTCACTGCGAAATGCATGATGACAAACCGAACCTTGTCATCTTGGACGTGTCTTCGAAGAAAGAGAGCAACTCTCTTCGTGCTTTGGTTGATTCGGGCG
CGTCGAACAACGTTGTTCGACTGCGAAGTCTATCGAGGCTTGACTTCGAGGAGGTAATTATACCTCGATATATGTTGGAAGTTCGATTGACAACGGGTGC
CATCGTTAAACCCGAGAAGCGCATGGTACGCGTGCGCTTCACGTATGAAGATCAAGATTTTGTAGAGACCTTTATCGTCCTGGATCTGGACGATAAGTTT
GACATTGTATTGGGCATGCCGTGGCTTGCACGGCATGATCCGGTCATCGATTTGGAGAAGCGCACTCTCCTGTGCTTCGGGCGCGACAGCGGAACAGTGA
GCGATGGCCCTGTTGCTGCTACGCACGCACCGACAGGTGCGCGCGACTCCCCACTTGAGTCAGCGCCTAATGCCGCTGTCACGGAGCGCCCTGGGCGCGC
GCGAGCACGCGCGCAGGAGCAGCAAGCGTCGGCGTCGCCGCCGACGGCTGAAGGAGAAAATGTGTTGATCTCGGAGATCGACACCCGCATTTCAGCGAAT
CAGGAAGAGTCTCCGACCTCAAGGGGTGCGGATGACGCAGGCGAGTCACACGCCTCAGCCGTGGAGGCTGACGCGAATCTGATTGGATCAGTTTTGGCCA
ATAATAAGAGCCAATGTGACGAAACGCCGTCGACTCCGGGAGTCGATGGATTGGGTGGATTTGATTCGTCGGCTCCGGGAGCCGACGCACCCTCCGTAAT
GGGGGTCTCCGCCAATGGTTGGACGGTTGCAAACTTGCATGCTGTCGTGCAGCCGGGCTGCACGACGAAGTGCCGGGCGACCAAGCCGGGCTTGAAGTCC
CTCGCCCGCGGGACGTACCAGCCGGCGGTATACAAGAAGAACACCCGTCCACGGCTGGGCCTGGACGAGGTCAAGAACCAAGCGGAGTCGGGCTCCGCAA
AACAAGAAGACGGCGCATGCGAAGGTCGCTGCGCCAGTCTCGACCTGGGGCCGAGACGCTACAAGAAATGTCTGCCGGGCAGACGGGGGCTAAGAAGCCG
GACGTCGAGACGTTGAACGTCTTGACGCGTACCTGTGCCGGGTTCCGGTACAGGGATATGACTCTCGCTAATCCTCCGACGCAAGCATCGGAGTTTACTT
CGCTTCCAGATATGAGCTGGAAGCGCTTCGCGCGTGACTTGCACGATGGACGCATCGAGCAAATATGCATTCTCTCGGACGCCGAGAGAACGAAGAGCGA
GAATGAAGAACTGAGGCAGTTCTTCATGGAGAGCACCACTGAGAGCGAGGACACTCTCAGTGCGAAGACTAAGAAGGAGCGCTTTGAGGAGCAGAGCTGG
GACTCGCTGAAGTCGGGTCCCTTCCACGAGATTCTAAGGGAGCACGCGGACGGGCTTCCGGAAGCGATCCCTGCGGAGCTTCCGCAGGACAAGGGCATCC
AGCACGAGATCGATCTCGTGCCGGGCACGAAGTACTGTGTCATGCTGCAGTGGCCACTGCCGCGAGAGCAGGTCAAGGCGATCGACGACTTCTTTGAGAG
TCGTCGCAAAGGGACAAGTGAGGGAATCGAAATCCCCGCACAGTGTGTCAAGAAGCCACAGGGCGGCTGGCGCATCGTTCATGCGTACAACAAGCTGAAC
GATGCGACGATACCGGCGCAGACACCGATACCGCGAAAAGATGTCATCATCGATTCGATGGCCAGGAGCACTATATACAGTGCTCTTGATCTGTGCGATG
GGTTCTGTCAGATCCTCATGCGTGAGAGCGATATCCCTCTCACGGCAGTGAGCACGCCGAGCGGCATGCTCTGGGAGTGGCTAGTGATGCCGCAGGGTCT
GAAGAACGCCCCTGCGACCTTCAACAGGTGCATGACGCACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTACTTCGACGATGCGTTCGTCCACAGC
CGGGCTGCGGACGGGATGAGCGATGTTGAGATGCACAAGGCGCATCTCCGGAAGCTGCTTGCGCTCATGCGCAAGCACAAGCTCTATGCGAACCTGAAGA
AGTGCATCTTCGGGGCGAGCGAGATACCCGTGCTCGGGTGTCTCGTTGGGAAGAACGGTGTCCTCCCTGACCCTGAGAAGGTCAGAGTGATCAATGAGTG
GCCGACGCCGTCGAACGTCAAGGAACTGCGGCGGTTCCTTGGCTTGGCCACGTACTTGTGCAAGTACGTGAAGGACTACGCGGGCATGATACGCCCGCTG
TCACAGCTCCTGAAGAAGGACGCCGAGTGGGTTTGGACTGCTGAGTGTCAGCAGGCCTTCGATGCAGTCAAGCAGGGCTTGACGGAGGCGCCGATCTTGG
CGGTGGCCGACCAAGATCGCCCATTCCACGTTGTGTGTGACGCATCCGACTTCGCAATCCGATGTGCGTTGATGCAGCACGATCACGAGGGCCGTGATCG
TGTCGTCTACTACCAATCGCGCCAGCTGAAGCCAGCTGAGCGCAACTACCCGGTACATGACAAGGAGCTCCTTGCCATGAAGTACGCACTCGCGAAGTTC
CGAGGGTATCTACTCGGAAGCAACCCGTTCGTGGTCTACACAGACCACGCGTCACTGCGGACGGCTGTGAAGTCGCCGCACATCTCGCAACGGATGGCGA
GATGGCTCTCATTCTTCGCAGAGTATAACTTCCGGGTTGAGTACAAACCCGGAAGACTCAATGTGGCGGCCGACGCGCTCTCGCGTCGACCTGACTGATA
CCGACGTCAATGCCATTGACGCCATGCGATCGAGCACCCCAACGTCGTCACTGCGACGTGAAGGTCGCGTACGCGCACGACGCGGACGCGAAGCTCTTGC
TGGCCTACGGCTCAGCGCCATCTGACAAAGCTCGTCAGAAGTTGCCGAAGCATCTTCGTGCTCGTGCACACCGTTATCGGGTGCACGACGGGTTATTACT
CTATAGTGCAGTCGACGACAACGCGGGCCGCGTTGTCGTGCCCAATGACCATGAACTGCGACTCAGGATCATGTTCGAGTATCACGATCCACCGACTGCG
GGGCATCCGGGCCGTGAGAAGACATACCTTCTTCTCACGCGAGACTCTACTGGGCCCACCAGTATAATTGAGTGCGCAAGTACGTCCGTGCTTGCGAGGT
TTGTCAACGTGTGAAGCCTGCGCCGTTCGCGCAGGCTCCCTTGCAGTCACTCCCGACTCCGTCGGAGTGTTGGCAGTCCATGTCTTTGGACTTCGTATTC
GGTCTTCCCCCGGACAGCCAGGGGGACACAGGCGTTGTGTCTTTGTTGGCCGCTTCAGCAAGATGTACCATCTTGCTGCTGTACCCGCTGAAGTGACTGC
GAAGCAGACGGCGCGTCTGTTCGTTGACATGGTGTTCAAACACCATGACATGCCGATCGACATAGTGTCGGATCGAGACCCGCGCTTCACTGCGCATCTC
TGGCAAGAAGTGTTTACACTTCTTGGGAGTCAACTTTCGATGTCGACTGCGGACCATCCGCAGACGGACGGGCAGACCGAGCGCGTGAACCGCGTGCTCG
CTGACGTGCTTAAGAGCTACGCTCACTCGTTCCAACACTAGGGCGAGTGTCTGCCGATGGCGGAGTTCGCCATCAACAACTCGGTGCATGCCTCGACTGG
GCATACACCGTTCTACGTGAATGCCATGAGGCACCCACGCCTCCCGAGTCTACTCGGGATGGTAGTTCCTTCCTTAAGTGGGGGGGGGATCTCCGACTGC
AACGCAGCAGCCGCAGAATGCCGCTGGCACTTGTGTCAGCTGCAACGACACGAAGTAAAGCCGAGGACCGCGCGTCTGTGCAGGGCACAGACACCGCGAA
GGCGAACGCAGAGGCCGGGCCTACTGCTGGAACCGAGCTGAACGAGTTCAGCTCGGACGCAATCAACTTCGTGCAGCGCAGACAAGCCGTCATTCGGTTT
GTCGAAGACGCTATTGCAGCTTCTGTTGATCGACAGAAGCTGAACGCAGACAACGTTGGCAGGGGCAACACAAATGAATTCAAGAAGGGTTCATTGGTTT
TGTTAGCTACTCAAAACCTGCCTAAACATGCAGATTCCGACTTCGGGGCGACCAAGCTCGCTCCGCGCTTCATCGGGCCGTTCACTGTGCTGGCACGGCA
CGGCAACGCCTTCACACTGGGATACCGTCTAGTATGCGCCTCCATCCGACGTTCTACGTCGGACGGCTGAAGCCATACCTGCAGTACGAGCTACGTAGCT
CGGCTGAACCGAAGCAGAAACTCGGTGGAAGCCGTCATCCTCACCAGCGCGAAAGTCGCGCTAGAGCAGCGGGTCGAGCTAATTGTCCAGCTCGGCCGGA
ACGATCGAGGCGGCGCCGCAACCTGAGGATACTTCAGAGCGCCGAACCCAGCGCTCTGGAACTACTCCACGACCGGAACTCGGTCGTGGGGAGACGCGAG
ATCAGGGTCAACACCAAGTTGACCACACACGGGGCGTGTTTCCACCACCACCACCGCCGATTCGTGATGCACACGGCTCAACCCGATGGATTCTTGAGCG
GATTGTTGATCACAGTATCCCGAGAACGAACAGGCAACCAGTTCGTTTTCGTATCCCTTGGAGAGGATTCCCTCCCAACCAAGATACATGGGAGCCGCGG
AACGTCTTGCTTGAAGACGTCCCGGACATGGTGAGGGCGTACGAAGCCCACCATGCGCTACACGCTGGAAAGTAATACGGGCGTTGTTGTTAACAACAGC
GTCCGAA