Description :
From Genome Similarity Track
Location :
Scaffold_1168:2833- 4067
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1168-snap-gene-0.4Ankyrin repeat protein

Sequence
1234 bases(100 bases per row)
TTGGGCGATCGTCCATGTCCCAGCCATCGGCAGGCAACTCGATCAGGATCTTCCCCCCGAGCGGGATCGTCCCATTCACGCAAAATGCCAACGACACATC
GGAGACTGCGCCAGGGCAGCAGCTGAACGGCAACCACCGCTTGGCTCCTGTGATTTGACCTGGAAGGAGCTTGGGGATCACGAATGCACACGGGCCATCA
ATGACCTGACCACCACGAGTGGACGCAGGGANNNNNNNNNNNNNNNNNNNNNNNCCGTCGAGCGCACGACCAGCTTCTCATACGCGGTGACCACGATCTC
AGCCTGCGGCGTCGCAGCCTCTGGAGTTGACACGCCCGAGATGAGGATCACAACTGGGATATCTCCACCGATGCCTTCACCCAGTAATGTGAACTCGAGG
AGACGCGTTGCCGGCTGCCAAGCGGACTTGAGTTGTGGCACAGCACAACCTTGCGGGAGCTTCAGCATCACAGTTGGGGATGCCGAGATGCCCCACCCAT
GGTCGGGGAATTGACACACGAGGCGACTCTCTTTCGCCAATGCGCCGTTTGTTGTAAAGCAAATCGCGACNNNNNNNNNNCCCGAACGCCTGGCGCTGCT
TCCTCAACGTCCAGCACGCGTCGACCTTTGAAACGGCCTGCGACAATCTTCTTGTGGCGCTGCGCGAGTNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCA
CCGCGCGCATTGTCATCTTGCTCTTCTTCAAGAGCGTCGTCATTGCCATTGGAGCTATCGAGGCGGCTGCTGTTGTTGTCATTGCTGCTGGCCATGCTTT
CACCTCGCGCACTCGCTGGATCGTGATCGCCCAGACGCCTCGCCATAATGTGCCTCCGTCTGCGCTTCCTGGGTGTTTGCTGCCACCGCATCCAGCCTAG
AGCCGACGAGTCACGCGTAGCGGTCTCCATTCACGTTAGTAAAAAAAATAACCGATGTTATCTATGAATACAATCCTGATCCGTTCAAATCCGTATCCAA
ACTCCATGGTATCTTTTTGATCGCCAGCATGGAAAAGCGCCTAAAGAAGGCGGTATCTTTTTGATCGCCAGTGCGAAATGGACTGTTGCAACTCGCCACG
CTGGTAAGAAAAGCGATATACACCGCGCCACGTTATCGTGGATCTAAGATGATACTTTAAATGCCGTTCACTCGTCCTATCGGCGCAATCGTCTGCGAAA
ATCTCGGTCAGCTTTTCTGCTGGTAAACTTTGGT