Description :
From Genome Similarity Track
Location :
Scaffold_39:283279- 284433
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G011984Similar to B11B22.010: E3 ubiquitin-protein ligase TOM1-like (Neurospora crassa)

Sequence
1154 bases(100 bases per row)
GTGGTGAACCCGTACAATTCGGTCTCCAAGGCAGCATAGAGCACGGCCTTAAGGTCGTCGCGAGACACATGGTACGGAAGATCCAATCGATTAAAGCACG
CGTGGCTCCAAATGTAACCATCATCTTTGAGTGGCACGCCATTCAGTGTGAATGGACACAGTCGTCCATCATAACTCGTTAGCGAACTGAAACCTGCGAT
GGGGACGCGCGACGAACCCGTTGCAAAGTGTAATAGACGCTGACGGTACTCGTTCGGCATCTCGCGGACCAGCTCCCAGAACCAGAGCAACGCTGGGTGG
TCGTATGCAATGTTCGAATACTTGGCATTTCGCTCCCAGTCGTCGACGTCGATCTCGTCCGAGCCACACAACAGGTAGTCAAACTCTTCCGGATCAAACA
GCATCAGCAGTTCCTGTGGAATCACTTCGTAGAGTCCTTTCAAGAACACATACAGCTGGCTGGACACGCTCTCGAAGAGCATGTACCGGAATCGTCGCTC
AACGTACTCGTCCTTGTTGTCGTCGGTCACGTCGATGCTGCGGCCATTGGGGATCAAATCGACCACGACCACCTCGTCACCTCGCTTCTCTGTGACACTG
AAATCAAGACCCAGAGCGCCAGCATCGTCGTTCTCAAGCATCCACAGTAGGTTCTTGTACGTCTCGGGATCAAAGTACTCGAGATCGGAGAACGTCACCG
GCAGTCCCAGAATGCTCTTGACGAGCGGCAAGCACAGATGGAAACCCAGGGCGTACCCTTCGAGCAGCGCACGCCCAACAAGCCGTCCCGTAGCGAAGAA
GTAGACCAAGTGGTTCTCACCGAGATCTTTATGAGAGTTTGCACTGAGGGAAAAAGTCTGCTCGTGCTTGTTGATGCAATGGAGTACCCCAGTAGTGGGA
TCTGCGAGACACTCGTTAAGACGCACAAACCATTCGCGGTGCAATCCACCAGCGTCGACGCCGGCTTCAGCGACGAAGTTGACCCGGATCACGGATCGCA
CACTTCGCAGAGGGATCACACTCAAGGACTCCATCGAGTCTTCGAAAATCCGTCCTCGCTTCACATTGAGCTTGATGATTTCGCATTCGGCGGGTGTGAT
AAGCGCCGCCGTTGTCGTCACGAAATGTGCATACTTGTCTGGGAATGGCTGTGC