Description :
From Genome Similarity Track
Location :
Scaffold_2062:2832- 4040
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_2062-snap-gene-0.2HECT ubiquitin ligase

Sequence
1208 bases(100 bases per row)
GCAGTCAAGGAATTGTCAGAGTATGCCAACCACCAGACTGCTTACTGAAGACGCCACCGCTCAGAATTTCCCAGCCAAGTACGCGGAATTTGTCGCCGAG
TCGGTCGCACTGATGGCACCAGCAGAAAAGGAGCTCCTGAAATTCAACGTGAGCCGTGAGCTGCTGTTCGAGGACTCGATGGAGTCGCTCAGCGTCATCC
CGGAGGCCTACATCCGCTCGTCAATGCGCATTAACTTCGTCAACGAGCCTGGTCTCGACGCCGGTGGGCTGCAGCGCGAGTGGTTCGTACTCTTGAACGA
TCGCCTTGCTGACCCACGAGCGGGCGTCTTTCGCTGTGTGAACAAGACCGAGCAGACTTTCTATCTGAACGCCAACTCGCTACACGACATTGGTGGCGAC
CACCTCATGTATTACTTCGCCACGGGTCGGTTGGTCGGACGAGCGCTCCTTGAAGGCCAGGTGCTCGGCTTCCACCTGGCGCTGCCGCTGCTCAANNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTTCCTAAAAGGCCTCTATGAGGTGATCCCCCAAGCCACGCTCCTGCGATTCGACCCTGAGGAACTCGA
CTACGTGCTCTGCGGGTCGGACGAAGTCGACGTGGACGACTGGGAGCGCAGTACGCTGGTCACCGCCTCGCTCAAGGGCACGCGCAAGTACCTCGTCAGG
TGGTTCTGGGAAATCGTGCGCGAGATGCCGAACGAGTACCGTCAGCGACTTTTGCATTTCGCAACCGGTTCGTCTCGCGTGCCGATCGCAGGCTTCAGCG
CGCTGACC