Description :
From Genome Similarity Track
Location :
Scaffold_11:283162- 285251
Sequence
2089 bases(100 bases per row)
CGACCTCAAAATAATTTTGCCTGGTGGATGGCTAACCAAGACTGTGGCTGACTACTACATTCATCGCTTCATCAATATGCACCCGGTTCTAAATTGTACG
TAGAGCTTCAACGTACAATAACAATTGACCTTGTCCGAACATCGACCGTTGCCGTCAAAAGAGCTGGTCGCATGGATCAACTGACTTGTCTGGTAGAATG
GGCGAATTACCCATTTGTGCTAGCTACTATTACCGGAAATGACCACTTGCGTTTTGTCGTTGTGGCTAATGCATTGCGAAATGGCACGGCAGAGTTGTTT
CATGTCATTTCTATAAAAGATTCTCACGACACGGCCTACTCATTTGAAGCTGTGAAATTGGTAATAGTTAAGGAGCGCTTCAAGCGAGATGACTACCTTC
GAAGATGCGACTGGAGCCACGGTGGTTTTAGCACAAAGCCCCAGCAGAGGAATGCGGTTGACTGTGGAATCTTTATGCTTTATTACATGGAGGAAGCTAC
AAAATGCATAGTGGAGGAGAAATACATGTTTTCTTCGAAGCCCATCTTAATTAAGCCGAAGCTTAAGACATGGACTACTAGCGGCTTCAATGCAATAAAA
AAGCAAAAAAATCCGACAAGAGTACTATTGCAGAATTGAAGAAGCAGCTGAAGAGTCCTACAAACGCTACAAGACGTCGTGACGAGGCAGTGTTAGTAGT
ATCATATTTGTCAATAAAGTTTCAGTCTTTTAAGGACACTTTTTCTTCTACTTAGAAGTATTAGATTATATTTGCAGTTCAATCAACGCAAGATAGTTCT
CAATGATGACTGATAGAGGTCACGGGTTTTAGGCAACGTTGGGCTTGTACGGAGCGAAGAAAAGAGTCACCACTCGGGGAGTTGACCGGAGCGAAGACAC
TTGAGGGGAAGAAGGAAGATTCCGAAGTGATTGATTTATCGGAGCTTACACTGCCTTCACTACCTAGGTCATCCAATCAATTGGTGCATCCGATCACCAA
CACTCTGCACTCGTCCAATCATCCTACTCGTATAATCATTGATAACGTAATCAACGTACCGTAATCATCGCGGGATCGTGTTGGACCGGTTTGGTTACCT
GTTTGTGGGTACTTACCGCCTGAAACCAATACCTCTCAACAATGACTGAACACAATCTGAGAGCATTTAGCCTGCCCTTTCGAGCTTATATACATTAATA
ATCACGTCCTGGAACTTCATAAACCACGTGGGCAGTGTCAAAATTCGTCTTGTGCTGTCTGCCGGTCTGGCAGCTTCAACTCGCCCCGCACTCTTCGCAA
GCAGACTGTAGCGCTCACAAAGTCGCTTGAAACGCTCCTGCAGAGAGAAAAGATGGTGTGTGTGGTCCACACATATCCATTTGAGTGGACCACGGCCATC
TTGTGTTGTCGGCAGCTCCGACACACTGCAAGTAACGTTCGTCTGCAGCGTGAACGCAGCAGCTTCAACTAAATCCTCTAGTTTTACCACAGCAGAGAAA
GAAAATGTGGGTGGTCCACACACATCCAGTTGAATGGACCATAAAGCGGGACACACTGTATTTCAATGTCACACGTGCACAGACTATGTGTGTACACTGG
TGCCCAGCACCTGTGTCTATTGATAGTCACATCGCTGTCTATTGGTGTCCTACTCGTGATTTTGTTCAACGTTGCTGCCCCTACCGAGAAATATAGTACG
AGCAAATCCTCATGCGGTTGCTAGTTCACAGACCCGGACAGCAAACAGGGGTCTTTTGAAATTTGGCCAATTAGATATTAGGATTTTAGTTCAAAGCAGA
CATCATTCGATTGCATTCGTTCTACTCTATTGACACCACTTCTCAAGCCGCAAAATTGCGATCACTAGGGCAGCAATAATGGTCGGCACCGATGTGCCCA
TACTAAAACCAAGTATAGGGCGCACGGGAGATCCACGCAGCATGATCACCTCAAAGAAGAGTGCACCGTCGACAATTGACCGGCACAGCTAGAGGATATC
ATCACCTACGCTATAAAACACCGCTCTGCCGTCGTCATCGAGAGCGAGAAGCTCGATATACTGCTACTCCACGCGGAAATGAGGTATGA