Description :
From Genome Similarity Track
Location :
scaffold_50:283118- 285681
Transcript NameFunction/comments
g9382.t1hypothetical protein

Sequence
2563 bases(100 bases per row)
GCGTTCACTGTTGTCTTGGGACCCCAGCCTGCTTCCTTCAGGAGACTCTTGTTCCTGAACGCCAGTCGCTTCACAAACTCAGTCTGGGAGCTTCTCGGTA
CTAAGGTTTTCAGAGCTCCGCGAGTTCGCTGCAGCGCCACGAACACGATTGAACTGGTCAGCGTTGGGTGTGAGGATGGCGGCATGAACGGAGGAATGGC
CGCAGTAACACGATCTTCTCCGAGACGGAGAGCTTCTTGAAGTGCTGCGACAACAGTTGACCTCACCTCCTGACGAGTCTTTGACGTGATCAGCATCTGG
AACGAAGCACGGGCGGCGGTTGCAGCGTCTTCATCTTGTGTGGCTGTCCGTCCAATGGAGAGCAGCCCGCTCTCGGACGCACATCGATCGACCAGCACAT
CAGCTCGTGGAGTTACAAGTTGGGCCATGACGTGCTCACACACGTCTGTCGTCACGTTTCCCACAACAAATTCCACTACCGCCTTCAGCTTCGGATGCAC
CTTGAAAACCGCCTCGGAAAGCTTGTCGTTTTCTTCCTGGAGCGGCGATAAAGTGCCGGGGAACGCCGTTGTCGGTGACTTCACTCCGGAAGTGGCTGAG
TACCCATCGTTGTCATGCTTTGAAGTGAAAGACGAGATACCACCGTTCTGGTCATCCTGGATCACCACCTGCAAGGGTCGGAGTTTGCGGATGGGTGTGA
CCAGCTGGCCTTTAGTTATTCGTCCGGTGCCAGTCGAGAGTTTCCTGCGTGGTAATGGCTGCGCACGAGTCTGAATGAACCCACGCAAGTCTTCCAGCTC
GCTCACGCAGCTCTGGACAAACACTTGGCTGTACAGGAATGGCAGGTGGTCTTCTCCTTCTCCATCCTCTGACGAGACTCCACCCTCCTTTGTGAGCGCC
AAACGCACGTTAGACGGCGGAAGGAGTTCTTCAGACAGATAGTCGCCGTTATGTATGAAGCCAGCGTCCAGCTTCATTACGTGGAAGATGCGCTCGATTT
GCATCGCAATGTAGAGTCCTGTCTCGCCCAGGGAGTTCAATCGCGGCGACCGATACAGGAGCTGCAGCAACACCACAAGTTGCTTGAAGTAGGTCGTTCC
TGAAGACAGTTTATCCAGCGAAAGCATCGTCAGATAGTCACACAGCCACGGGATGCACTTGGAGATGGATGCCTGGAGGATGCTGTTCTCCAGCAACTTC
TTAACGTCGAGACTGGAGTCGCGCGCCACCTCTAGTGTGCTGATTCCTTCACGCTCGACAGCCTTGAACGCAGCATTTTGCTCAGATAGCTGGCGAATCG
AAGACGTGACTTCCCATTGCGGCGAGAAGCGCAGATATCCGAGGAATTTTGCCATCACCTTGAGTCTTAACACCAGTTCTGTGAAGTTGTTCCGAGCATC
AGCAGAGGGGGAGGTGTTTTCTCGAATGGCGTAGAATTGCCGCTCTAACTGGTGTTTGACAAGCTCGGAGAACTCGTAGCTATCACAGCTGTGCAGGAAG
TGAAAGAAGAAGAGCTGGTTGTCCGTAAAAAAACTCTTCATCCGATCAAGCGTTGCCGTGAACTTTTTGGTTGCGTCGTCTTCGTTGGTGGTAACTCTCG
TGTCCTGCCGGGGTTTCCATGGCGAATTGTTGTTTCCCTTGGCGCCAGTCCTGTTGTTGCTATTGCCTGAGCCGTTCGAGCCGGCGTTGTCACTACTGGT
ACGCAGATGCGGCTGCGGTGACTTATTCAAAGGCTTTTGGTTTGAAAAGCGCCGATGCAGCTTGCGCAAACGGTCCGGGTTCTTCACCACGAGTTTATCC
TCCATGATCTTCAGCACAAGTTCCTTATCGCTTTCACCGAAGGGGTTGGAACCCACTTGCAGTAATTCCTGGACGAAGAATTTGGCGAACCACCACCTGT
TCTCAGGAAAGACCTCAGCTAGCAACTCCCGCGCAAGCGCAATAGCTGCTGCTGCCACACCTGCATTCTCGATGCCGACGAGACTGTGCTGCTTCTGCTG
GAATTGACGCAGTAAGCTGAGAAAGCCGTCCCGGACCTTCTCGCGGTTTGTGTACAGGAGGGATTCCGCCGGCGTCCGGTAGTGCAGGCGCGAGTCGGTC
TCTTCGTTGAAAGGGAGTGCGAAGTCTCGCACGGCACTTGCTTTCATCTCAACTGGCAGCTGACAGCCGACTCGAGCACTTTCAGCCACTCGGAGCTCCT
CGCGCTGGCGAGACACTTGGTCAAGTCGCTCCAACATGGACGAGCAGATGCCCTCGGCGTCGTGCAGGCTGTGCTCGACTAACTTGAGCAGGTCCGAGCC
AAGATGTGTCAGCACCGGCTCAATCTCATGAAACACGATCTCTGCGAAGTCGAGACAGTGGTCACGCCAGCAAAACTCCGACGGAGCTTCGCAGTTGTTA
CCACCATCACTCCCCGGCTGCTCCTCATTGCTGCTGCAAGCCGTGCAATTGGCCCGATACAGCAGACTAATGAGCACCTGCAGCTCGGCGCACGTACTGC
TCACAAACCGCTCTCTGATCAAAAACCCGTACAGCCTCGCCGCTTGTCGGTTCACCTTGAAGT