Description :
From Genome Similarity Track
Location :
Scaffold_146:28308- 31508
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_146-snap-gene-0.2230S ribosomal protein S16
Pytap_DAOMBR444maker-pag1_scaffold_146-snap-gene-0.32Nucleolar protein

Sequence
3200 bases(100 bases per row)
GACATCATGGTGGTGAGACTGCGACTGGCGCGCTGGGGCCGTAAGGACCTCCCGTTCTACCGCATTGtGGCCGCTGACTCGCGTGCGCCTCGCGACGGCA
AGCACCTGGAgATCGtACGTGCACGTGGgCTGGGTTGTGCGCGAGGAAGGGGGAgAGGCGACTGACACTGGCGATGctGATTGACGCACACAGGTGGGCA
CGTTCAACCCGATCGCTGCGAGCGACGGCGTCAAGGAGCTGCGTGTGAACAGCGAGCGCGTCAGATATTGGGTCAGTGTGGGCGCGCAGCCGTCGGACCG
CGTGGCGCACCTCCTGGGCCTCGCAAACATCCTGCCGGCCCcACCAACCCGCCAGTACTCGAAGAAGAGCGTCCCGAAGAAGGACCGCGAGGCCAAGTAG
ATGaGAAGCCTGCTACTAGTAATACACGAGCCCGCCCAtGCCTGCTGtcGGTCTCCTGTGCGTCGTCGCGCCATCTCTGTTTCTGCTTCTGCGTGTCTAT
ACAAGGTCACGTGTATTGCGGAGCTCTCTACTCGTATGTCTAGTTCTTGGGCAATCGTCGCTTCTTGGccggACCCGAGCCACCGCCCTTGAGCATGTTG
CCGCCCTTCTTGGCCTGCTGGTTGAACGTCGCGTTCTGCTCCTCGAGCCACTTCCAGATCTCCTTCTGCTTCTCCTTCTTCTCGGCCACGCGCGACTGCT
CCTCGTGCTGCTTCTCGCGAGCCAGGAACGCCGCGTCGCGACGCAGCTCGCGCGCCGCGTTCTTTCGTGCGCGCTTGACCTGGCGCTCGAGCTGCTTGGT
CTTGGCCTTGTCGCGATCCATTGTCTTGTCCTTGCGCAGCGTGTAGTTGGCATCGAACTTGGGCATGAACGTTGGCAGCACGCTCGGTCCGAATGTCTGC
AAACGCAGCGGCTCGCGCTGCTGCCAGCAGCCTGCCAGGCGCTCGTGGACGTTTGCGATCACtGTGTTGAGTTGCTCGTGGGCACCGTCGAACAGCGAGC
GCGCAAGCTCATGCAGTAGCAAGTAAAGTGGATACACGAGCTCATCAAACGACGGCAGGtAaCGCGTACTGGGCGCTCAGCTGGTCAaTCACCTGgAGCG
TCGCGTGCAACACGCTAGGACCAGAGACCGACGATGCGCTTGCGAGCGACAGAGGCGGCAGCGCGACCATCGACTCATTGGTCTCGAGCCACTGCTGCAG
ATCGACACGAAGCCACTGCTGCGAGTCTTCAACCACGAAGGCCCGCAGGAGCTTCTtCAGACACACGATAATCTCAGGCGTGAAGCGCTGCTTGTCCTTG
GTCATCTGCAGCAGCAATGTGCAGACGAAGAGAGCGTGTGTGGCGTCCTGCGGAGAGTCCACGGACCCACGCACGAGCGACTCACTCAGGAGCGTCTCCA
GTGGCGACACGACATTGTGGCGCAagTCGGACGTCGGGAAGATCTGAATCAGTGCCTTGAAGAGCAGCAGCTCCGCCAACTGCGGGTACTTGGACACGGC
CTTGTTGCTGTGGAGGCGCTTGTACAAGTTGATGAGCAGCTCACGGACGACGATACCCGCCGTCTCGCTGATCTCCTGGGCCAGCGTGAAGAGGTGCTTG
GCGAGCGCGCTGAGgTCCTCCTTGTGGATCGCATACTGCTTGCCCCACTTGAGAAACTGACGCACAAGGATAGCGAAGAACGATTTCATCTTCTGCTGGT
TCTCCACACTGAGCTTGGGCGAATAGAATTTGATGATACGCTCCACAATCAAACCACGACGCTCAGCCGAGTTGTGAGCATGCTCCTTGAAGAGATCAGt
cAGATCTTCTGGAGACTCCGGACAAGGGAAGACGAACGGGAGCTCTTCTGCGGCTTCCTGGCGCTTGCGCTTGCGCTCCGCCTTCTTCGCGGCAACGTCC
TCATCAGCATCTTCCTCTTCTTCCTCTTCTTCTTCCGCGGATTCCTCCTCTTCTCcGTCGGCTTCTTCATCCTCGCCTTCGTCCCCCTCTTCATCaTCCG
AGCCAGCGTCGCTGTCCTCGTCCTCATTCTCCTCGTCTTCTTCTTCACCGTCATCCCCCTCAgtCTCTTCATCCTCTCCTTCCTCCTCACCCACAGCTCC
GAATCGCTGGTCGACCTGGTAATCGGCAGCGAGGTCATCGTCTGTCGGTGGCATGATGATCATCTGTGGCGCTTTCTTCTTCTTGTTCTTCTTGCCTCCC
TCCTCGTCGCTGTCCGCATCCTCTCCGTTCATACGTGCCACACGCTTCCGTtCAAGCTCCTGCAGGCGgTCGTGCTCGCGCTTGGCCATCTCCTCAGGCG
ACATGCGGCGCTCAGACGCCTGCGCCTTGGCCTCGAACGTCAGCTCGCGCGTGAGCTTGTCAAACTCGTCCATTGGCGTGTCCTTCTTCTCCTGTCTCTC
GAGGgCTGCCGCCTCCTTCGATCCCTTcGTGGGgCGgAATGACAGCAAGCCCTTGAGGCTCGCAAACTCGGAGTCAAGTGCTTCGGTGGCATCTTCCTGC
GCGGCCTTGTtCTTCTGGCGCTCGGCCTTGAACAGCTTCGACTTCATCaTGACCTCCTGCATGATCTCCTTGTGCGACTTCTTGCGTTCcGGTCCGTCCG
ACGCGACTTCATTGGCTCCACTGCCaCCACCAAAGTGCAGCTTGTCGACAATCTCTCGGTCCATCTTCCGTGTCTCTTCATCGTCTTCGCCGTCGTCAAA
CGCCGTTGGATCCCCGGCGTTGAGCTTGTCGTAGTCGTCAATCTTCTGGCCCTTGTGCGTCAAGAaCAGCTCCTCCGTGTCCTCGTTCTCATCGTCCGAG
TCTTGCAAGGCAAaCGCCTGGGCGTTGCGCATCTTGCGCTTGCGTTCCGTCTGGAAACGCGCCATCATCTTGTCCTCCAGCGACATCTCCGGGTCCGTTT
CGCCGAGACGGCGGTCCTGGAACGCGTTGGCCTTGTTGCGCTGCTTGAaCTGCGCCGACAGCGTCTTCTTGCGCTTGGCCTCGGCGTCGGCGCGCGCCAC
GGCCACGTTGCGGCCCGCGCCCTTGACGCGGCGACCCAGCACTTCATACTTGGTCTTGGCGTTGCCGCGCACGTCGAACGGATTGACGCCGCTCTTGGCG
CCGgCCTTGGCCTTGACGCGCGCCTTCATGCTGCCAGTCTTCTGCTTCTGCTTagCGCCGCCCTCGGCGCTGCGCTTCTTCGCGCTCCCcACCGCCATGA