Description :
From Genome Similarity Track
Location :
scaffold_19:283063- 284706
Transcript NameFunction/comments
g10891.t1 cryptochrome, putative

Sequence
1643 bases(100 bases per row)
GTCGAGGCGGGCGATCGTCTGGTTCCGCCGCAACTTGAGACTACACGACAACTTGGCGCTGGACGCGGCGATCCACTCGCAGCAGCAGACTCTCAAGGCG
GGCGAGGGCGAGATGGCACTGCTGCCCATTTACATTGTGCATCAGCCCGTGAAGCAGCGCTGCGGACCCGTGAGGTTTCAGTTCTTGCTGGAGGCGGTGC
AAGACTTGGCCGACTCCATTGACAAGCTGCAGGGACGGCTGCTGGTGCTCAGAGGAGACGCCGAGGAGGTGCTACGTGAGATTCTCCCGGCGTGGGGCAT
CACGGATCTTTTCTTCGAGGCGGGCGTCATGCCGTACGCCGTCGCGCGCGACGAGCGCGTGCGGGCGATTGCAGCGGCTTTGGATGTCACGGTCGCGACG
TTCTGTGGGGAGACGCTATACGACCCGCACGAGATCATCCGACGCAATAACGGTGAGCCTCCTACGGACTACGAGCAGCTTCTGAAGATCACCGACGATA
TGCAGCCGCCGGGACATCCGATTCCCGCACCAGAGCAGCTAACCAACGCTGCAAGGTTCACTATCGAGCAGCTATTTGCAATGTTAGAACAATTCTGCCA
CCACAACCCACGCCTCGCGAACTCCATCGCTGGAATTGAAACGAGTACATGTACCACGAAGGCGTCACCCGAGCTTTTCGTTGTACCACCGCTCACTGCG
TTTGGATTAACCCCGCCAGAAACTCACATCTTTCTGTACGGAGGTGAAAGCGAGGCGAGGCGATTATTGAATGCCTTCTCCCAGGACCAACAGCGTGTGG
GACTCTTCGAGAAACCCCGTACTTCCCCAGTGACAATTGACGCACCGTCCACCACGTCGCTGAGTCCGTACCTTGTGTTCGGCTGCCTTAGTGCACGCGA
GTTCTTTCATTGTATTATGGTCATCCAGATACAATTTCCACAGCGGCCTGGTCCAACGCAAGTCACACTGGAAGGACAACTTATGTGGCGCGAGTTCTTC
TACTGTTACGCTTGCGGCACACCGAATTTCGATTCACAGGAGCGCAACCCAGGCTGCAAGCAGATCAAGTGGCGCCTGCGACCTGAGAACCATGAGCCGT
GCCCTGAAGACGGGTGCGAACGGGTGAGTGCCACCGATGACGCGGACGAGAAGCTGGCGATGCGTCAGTTGCAGTGCTGGAAAGATGGATGCACAGGCTT
CCCGTGGATCGACGCTGTAATGCGACAGATTAACCAGGAAGGCTGGACACACCACGCCGGCCGACACGCCGTGGCTTGTTTCCTGACAAGAGGCGTCCTC
TATATCTCGTGGCTACAAGGCGCAATGTACTTTCAGGAGAAGCTCGTCGATATGGACTGGGCGCTAATCGTTGGCAACTGGCTCTGGGTTAGTGCGAGTT
GCTTCTACTCAGACTATCGTCGGGTGGCGTCTCCGTCAACCTTCCCACAGCGGTGGGACAAAGAAGGTCGGTTCATTCGCAAGTATATTCCAGCGCTCCG
TAACATGCCAGACAAGTTTGTGTTTGAGCCCTGGAAGGCTCCGTTAACAGTACAGCGTAATGCTGGGTGCCTCATGGGAAAGGATTACCCGTTTCCTATC
GTAGATGGGAAGCACGCAGTGAAGCGATGCATCACCGGCATGA