Description :
From Genome Similarity Track
Location :
Scaffold_2361:2830- 4049
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_2361-fgenesh-gene-0.1RabGAP/TBC domain-containing protein

Sequence
1219 bases(100 bases per row)
GTGACTCGGGGAATCGGCAAAATAGGTCTGGAGAATGAACGCGCGCGAGAGCAGCGGGTCGATCTCGTCTTCAACCCAGTCCTTCGTCGGCAGGTGCTGT
AGGAATAGCACGAGCTCCTGGAACTCAAGCGCCTTGAGTTTATCCCCAAACGTCATCAGGATCGCAGCGCACACGTACACGTGGAAGCTCTCAAAGCCGT
TGTCTTCGCACAGGTACGTGTCCCAGAGCCGGATGATCGCGTTCAGCGGCACCTCGCGCATCAACAGGCAGTTCATCCAGCGGAACGCGAATTGCACGAA
CTGCACGCCCTCGCGCTCGACAATGTGCTTAAATAGATCGGCGTCGCAGCGGTGAACCAGCTCTTCCATGCGCTGCACCATCCGCTGGAGTCCCGGCTGG
GCGAAAGTGTAGTGATCCTGGATGCCGTCCAGGAGCTTGGTCAGACACCAGTAGCTATCCGCTTCGACAATCTGCAGCGCTGTCTCCGACACGACCGACA
AGTCGCAAATCTGTGGCTCGTCTGTTCAATCAGGATAGAAATGATAGTATGAGCACACACAGCAAGTGACCTTGACACAATATAAGTTGATAGGCGTACG
CACCAACGTAGGCAGAGAGGAAGACCACCAAGAACGGCGTCAACAAGTCATTGATGCCCTGCACGTAGCCACTGGCGGGATGCCGAATCGCCCAGGTATA
CAGCACCCGCTCCATCAACTACAAGCAAATCAAAGCACACGTGTCAGCTCGCGACCTACACACAGTGCACATGTATACAGCGTACCTGGTGTATGCGCTC
CTCTTTGAACAGCTTCAGATCCGGATTTGTTCGTGGAATGTCGACCAAGATCTGGCGGAGCGTGGTCTGCTCTTTATCGCCTCGATCTGTGTCTGGGATG
TAGTAGTATTGCTGCAGCAAGTCCACATATTCTTGGCGCTTGCGCTGCAGCATCGGCTCTCGACGATCCTGCTTCGACGGCATGTATCCCTGTAACCACG
CAAACAAGACGAGTAAGTCAACAAGTAAGGCTCGGCAACTGAATGTCCTGCAACGAAAAATGCTCGTACCAGAAGTAGTCGCCACGCAGTCGGTCGGTGG
TGAATTGGGATCCCGCCCCAGCTCAGCTCTCGTAGTTTATCCAAATCCACGACGTCGCTCTTGAGTATTTGGTGAAACTGCTCGCTGCGGTGGTTACCAG
CCGCATTGCGAGACGCAGG